-
Describe extraordinary emergence of Eukaryotic cells, while including the term endosymbiosis.
-
differentiate chime from bolus
-
When the F1 are inter-crossed, F2 progeny are produced in the following ratio: 9/16 disc-shaped: 6/16 spherical fruit: 1/16 long fruit . Give the genotype of the F2 progeny. 2.
-
What are the types and sources of sediment that enters the ocean? Make at least 5 examples. Explain each
-
how is genetic engineering being used?
-
kudza vines food web
-
Which process listed does not require oxygen be present? Check all answers that apply. A. anaerobic respiration B. aerobic respiration C. ethyl alcohol fermentation D. lactic acid fermentation
-
You have a piece of DNA that includes the sequence: 5'GATGAGGATGAGGAGAAGTACCGGCCGCCGCCTGCGCATCACAATATGTTCAGT 3' To amplify this DNA by PCR you would use a pair of primers containing which two of the following eight primers
-
describe the major contributions of hooke and leeuwenhoek to cell biology?
-
A cell biologist carefully measured the quantity of DNA in grasshopper cells growing in cell culture. Cells examined during the G2 phase of the cell cycle contained 200 units of DNA. What would be the amount of DNA at G1 of the cell cycle in one of the grasshopper daughter cells?
Ask a new Biology Question
Tips for asking Questions
- Provide any and all relevant background materials. Attach files if necessary to ensure your tutor has all necessary information to answer your question as completely as possible
- Set a compelling price: While our Tutors are eager to answer your questions, giving them a compelling price incentive speeds up the process by avoiding any unnecessary price negotiations
Sample Questions
- 1. Protons are generated during photosynthesis. Describe the fate of these protons and explain how they contribute to the conversion of light energy into chemical energy.
- 2. Hi. I took our first biology test and messed up big time. I need the correct answers so I can review for the final. Can you help?
- #1) Which of the following bacteria does NOT belong with the others? (I chose B)
- A) Staphylococcus
- B) Halobacterium
- C) Sulfolobus
- D) Halococcus
- E) Methanobacterium
- #2) All of the following bacteria are motile; which does (do) NOT have flagella? (I chose C)
- A) Spirochetes
- B) Helical Bacteria
- C) Salmonella
- D) Escherichia
- E) Pseudomonas
- #3) Which one of the following does NOT belong wih the others? (I chose D)
- A) Rickettsia
- B) Wolbachia
- C) Ehrlichia
- D) Coxiella
- E) Staphylococcus
- #1) Which of the following bacteria does NOT belong with the others? (I chose B)
Create a free account to get your question answered.
Sign up with your Email Address. (Already have an account? Login)
By creating an account you agree to our privacy policy, terms of use, and honor code
