Prelim_1_key - BBM332 First Prelim Spring 2007 Name_KEY 1 2...

Info icon This preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
BBM332 First Prelim Spring 2007 Name : ______KEY_______________ 1. __________ 2. __________ 3. __________ 4. __________ 5. __________ 6. __________ 7. __________ 8. __________ Total __________ 1
Image of page 1

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
1. (20 points) Name the structures shown below in the space provided. Number each of the atoms on the purine rings. Circle the atoms that form the N-glycosidic bond with the pentose. Adenine Guanine The following atoms (or groups attached to them) on the ring 6, 1 for A and 6, 1, 2 for G are involved in H-bonding in the Watson-Crick base pairing and 6 and 7 for both A and G are involved in the Hoogsteen base pairing. 2. (14 points) Name and draw the alternative structures that can be formed by each of the following DNA molecules under certain conditions. Line drawing is sufficient. A. GCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGC CGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCG Z DNA cruciform Left-handed helix (formed in (B-form in low salt) high salt) B. AATGCCTTTCTCTTTTCCCCGAAGCCCCTTTTCTCTTTCCGTAA TTACGGAAAGAGAAAAGGGGCTTCGGGGAAAAGAGAAAGGCATT The B-form DNA duplex of A and B are exactly the same length. Which has a higher Tm? Explain in one sentence.
Image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern