Prelim_1_key

Prelim_1_key - BBM332 First Prelim Spring 2007 Name : _KEY_...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
BBM332 First Prelim Spring 2007 Name : ______KEY_______________ 1. __________ 2. __________ 3. __________ 4. __________ 5. __________ 6. __________ 7. __________ 8. __________ Total __________ 1
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
1. (20 points) Name the structures shown below in the space provided. Number each of the atoms on the purine rings. Circle the atoms that form the N-glycosidic bond with the pentose. Adenine Guanine The following atoms (or groups attached to them) on the ring 6, 1 for A and 6, 1, 2 for G are involved in H-bonding in the Watson-Crick base pairing and 6 and 7 for both A and G are involved in the Hoogsteen base pairing. 2. (14 points) Name and draw the alternative structures that can be formed by each of the following DNA molecules under certain conditions. Line drawing is sufficient. A. GCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGC CGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCG Z DNA cruciform Left-handed helix (formed in (B-form in low salt) high salt) B. AATGCCTTTCTCTTTTCCCCGAAGCCCCTTTTCTCTTTCCGTAA TTACGGAAAGAGAAAAGGGGCTTCGGGGAAAAGAGAAAGGCATT The B-form DNA duplex of A and B are exactly the same length. Which has a higher Tm? Explain in one sentence.
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 02/13/2008 for the course BIOBM 3320 taught by Professor Tye,bk during the Spring '07 term at Cornell.

Page1 / 5

Prelim_1_key - BBM332 First Prelim Spring 2007 Name : _KEY_...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online