KIC Document - ‘ xb’ibofil“w 4” Test 3 Bio Sci 2...

Info icon This preview shows pages 1–4. Sign up to view the full content.

View Full Document Right Arrow Icon
Image of page 1

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 2
Image of page 3

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 4
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: ‘ xb’ibofil“w 4”? Test 3 Bio Sci 2 , Gengatl enetics R Q g FULL NAME 4 4 DISCUSSION DAY AND TIME Be sure to show all your work to convince the grader that you understand the principles involved. 1. Describe the concept involved with the following terms sufficiently well to convince the grader that you understand: (2 pts. each=10) silent mutation-- base fur c MAM limi- “HM‘ “UL ““4'!“"”"'“ ‘5, SucL Wei HAL 5am amino M523 i:\ skids-"lam . . r“ - , '1'". . _ \ neomorphlc mutation" aft/MW 87 m“ L ‘M L. :‘VLL m MIL.” : a t q 1 1 i . 1Q) r i :— {Cl ‘i gin/LL an“) {I L6 M r _-. J J " ,-. f. 24:". F. .‘1 i ,_ ‘ ,r . ' ‘I we in: ‘r- H ii‘ie m net r- ‘ frameshiftmutation—- I) a). . a 1 H: w 1 ‘ w . r' A 0‘ lilo“ OF (FifflTzon Dir mat This“. a. r- -' 1&qu +0 (“KN/9t So “\EDIS'QMM uncorlloravit LAJ'TJA‘Q tamer... ,-= ,‘ ’ baci’Sif’ffi/h in Mm} 6'7 1"‘3r1, i olar mutation—- .. a . x . A i . -7 P n . H A.» 4 . p ir'an3(r\[ii:an\Tram-mTeD'M-Qit. UCLMF m "’5 “J” 01L ‘i’T/UL QQQYDA or Sir-,6. thym1ned1mers-- m +954w1 LANE/LN Laue Fromm, our-2L 1; r; u . -- 1 )5 -n, Ins-(Firm 3‘ TA '-i‘ fort: L ' 72-8 '1‘. ~. a“ f M a / t _, It VI A i H I: _ " “mi iii/Mm ~93 ya 57’ Lap-awe; WM fio\bk§3\ "(pt “‘ A / SEC/1 Tam: U Mai-Affli‘J A . 2. If thymine makes up 20 percent of the bases in a specific DNA molecule, what percentage of the bases are: (2 pts es=10) thymine-- O L/ ‘ r0 r' f" I 9‘? cytosine-- f0 0 "diff +— 5&6 guanine—— /00 ’3;— : /::7/ . _ : n .. aden1ne—- ’— , A The nucleotide pair that has three hydrogen bonds-- 3. The intermediates A, B, C, D, E and F all occur in the same biochemical pathway. G is the product of the pathway and mutants 1-7 are all G -, meaning that they cannot produce substance G. The table shows which intermediates will promote growth in each of the mutants. The + sign in the table indicates that the strain will grow if given that substance, while a - sign means a lack of growth. Arrange the intermediates in order of their occurrence in the pathway, and indicate the step in the pathway at which each mutant strain (1-7) is blocked. (10 points) Supplements: A B C D E X’J‘ Mutants: 1 + + + + + - + /2; - - - — - - + , 2x”! - + + - + - + _/. if} I J A" - + - - + - + 5 ' + + + - + _ + 6 + + + + + + + .7 - - - - + - + MM —, A) 7/" '7 5 l {’1 4. The table below lists several genotypes of the ac gene region in E. coli. Use your knowledge of the regulation of this system to complete the table. Use a plus (+) for when Beta-galactosidase (lacZ) and permease (lacY) are expressed and a minus (-) for when they are not, depending upon whether lactose is or is not present. (10 points) B-Galactosidase Permease No lactose With lactose No lactose With lactose I' P+ 0c Z+ Y' 4 I 4:. x “ I+ P+ 0+ 2' Y+ /' ' ‘ 1+ P' 0c 2‘ Y+ .54 7‘! 7 c... f I' P+ 00 2+ Y' ' / m i 1+ P+ 0+ 2‘ Y+ ' H —— J I' P+ 0c z+ Y' A /' I” P+ 0+ 2‘ Y+ 2’ l *7“ + I‘ 1" 0+ 2+ Y+ A . " f l' P+ Oc Z+ Y" I 5. What is the role of the following in the process of DNA replication?“ (3 pts ea.=15) ‘ \ " - a q; "x f‘. g\ 5/,“ f; , x ,/ // DNA polymerase III“ \mnj ‘ ¥LAL L; 3‘ U9— ‘ q L»: K g r _ . .\ / X l/ w ‘ \x /‘ - M '. EX} ’ DNA Polymerase I-- '. f ‘x - 5551 my awn-Hat u—L NV , \ \ \ \‘\ ,/ Okazak1fiagments-- smut emf/aim _...4-“"3r\ ‘« x m" "~ VA” ( “J's-4:; p ” f”- v '3‘)”- \ i , \ primase-- UU\U&L‘\'”‘-.L12[\-MU-.\ ;.; 9- " w \ J \ “gage-.. {I .‘ " IL; ER *3 ‘ PAH-“J fl" f '1 'L.‘ 1 R (I / a 6. What is the role of the following in the process of translation? (3 pts ea.= 15 points) [4&th "Ha-3‘ 9“ akin ‘.‘,: 1; “It! or 1 er 1 r c I you AK , peptide bond—- 1 cumin '3 “1’ - \; x, - ‘x- 7 5/: ,- (THUR/"i NWMM '* i ‘1?" .2} P site-— what lbw / I If .‘ f :>/\ Z . Shine-Dalgamo sequ/eg -- M A “3—5 E? NA . r30 ‘ 9' A “I, ’ Ric/.- l// \_\I‘ . 3,; release factors-- t-Ux CW1 ML M gin/A Va 6?: NA . \ ‘ ELK/L \J «at 7. A doubled-stranded DNA molecule with the complementary sequence shown below produces a protein that is FIVE amino acids long. Use your knowledge and the genetic code table (next page), if needed, to answer the following questions. (30 points) .5 ( acid 1’“ (\rfig (Siat' “it ’ . of“ \ i‘ ' it; €34 MW 15‘ TACATGCIAGgAAITQCGTGA®GAI§§ GTA ‘5 ' 5 ! ATGTACGATCTTTAAGGCACTTTACTAGTACAT 23* /Which strand of DNA serves as the template during transcription of the mRNA for this " protein (iabel it above)? ,9 at it 1,111 which direction (draw an arrow on the template sequence above)? a...) ‘ Label the 5' and 3' ends of each DNA strand. = «1 KW here is the translation start codon encoded (Circle and label it "start" on the template ‘ ‘li strand)? Where is the translation stop encoded (Circle and label it j§t0PI",0§1th/e 939mm“: Strand)? M “if ft 7 LJ_I.£_..E.,'.-i _/‘ (3 i What is the sequence of the messenger RNA for the portion that encodes this protein? L K C r K 1-- ,.4- (9 ’1' A /~‘:_ ’5‘ '- a as a Li c) A. U u. g i A What is the amino acid sequence of the protein? 7 {4 air {it Hi! ,If replication of this DNA is proceeding from left to right, draw a line diagram (below) opening this DNA molecule and showing the position of the new leading and lagging strands. It is not necessary to copy the nucleotide sequence. I \ ilftqadr #17 ...
View Full Document

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern