05Translation - Translation 5’ Overview • amino acids...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Translation Overview amino acids  codons peptide bond polarity amino vs. carboxy end tRNA anatomy 3’ stem anticodon arm T ψ C arm D arm The genetic code start codon stop codons degeneracy near universality Wobble rules effect Ribosome anatomy rRNAs ribosomal proteins ribosomal subunits Prokaryotic translation initiation elongation termination (1)                                                           U               U             G                    G                                                                               I                          I                 I                                                                                     (-)   (+)                              (-)    (+)   (-)                   A                    G                                                                       A           C                 U                                                                                   C                U                                                                            Prok rRNA                  proteins                               subunits                                                                                            50S    23S       5S                                                                                                       70S           16S                                                                                             30s 8 5’ 3’ N—H O H H—N O N N N (3’ ¬ tRNA 5’) anticodon codon (5’ mRNA 3’) N N N H H NH 2 O H N N anticodon N N O O codon N N H H—N N O O anticodon N N H N N N H codon O H N N N N codon O O anticodon N N H NH 2 anticodon O H N N H—N O N N H codon anticodon O H N N N N O O codon N N H anticodon O H N N N N H—N N N N N H codon UAGGAGGUGCGCAAAUGGGACUCUUUUAGGGCUCACAUUAGCG 5’ 3’ A  C  A  A U CC UG GA A met
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 04/15/2008 for the course BIO 325 taught by Professor Saxena during the Spring '08 term at University of Texas at Austin.

Page1 / 7

05Translation - Translation 5’ Overview • amino acids...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online