03Transcription2 - a gatttgctt. .. AAUUGUGAGC. . . mRNA of...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Transcription Information flow and the Central Dogma Francis Crick transcription: RNA polymerase translation: ribosome reverse transcriptase coupled Overview and Definitions initiation promoter elongation triphosphate ribonucleotides template strand vs. sense strand termination downstream vs. upstream numbered nucleotides conserved sequences mRNA Transcription in Prokaryotes -10 and –35 sequences consensus sequence holoenzyme, sigma factor, core enzyme NusA intrinsic termination rho-dependent termination mRNA Transcription in Eukaryotes Transcription of rRNAs and tRNAs TATA, CAAT, and GC boxes cell composition RNA polymerase (RNAP) II nucleolus transcription factors RNAPs I and III termination 4
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
DNA 5’ 3’ TTGACA AACTGT TATAAT ATATTA A T ...NNNNNNACCCCAGGC TTTACA CTTTATGCTTCCGGCTCG TATGTT GTGTGG A ATTGTGAGC. .. DNA mRNA A sense strand template strand 5’ 5’ lac  promoter in  E. coli -35 sequence –10 sequence +1 -35 -10 +1 -20 .. taga gccacaccc tggtaag ggccaatct gctcacacaggatagagagggcaggagccagggcagagca tataagg tgaggtaggatcagttgctcctc
Background image of page 2
Background image of page 3
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: a gatttgctt. .. AAUUGUGAGC. . . mRNA of lac genes sense strand TATAAAA ATATTTT YAY RTR GGCCAATCT CCGGTTAGA GGGCG CCCGC AGAUUUGCUU. .. mRNA 5 5 3 GC box CAAT box TATA box +1 sense strand template strand AY 5 mRNA-25-75 UPSTREAM CONTROL ELEMENT CORE ELEMENT-150 -100-50 +1 sense strand template strand rRNA 5 5 3 5 5 Prokaryotic Promoters a. Consensus sequences and positions of promoter elements b. Example: E. coli lac gene promoter region with promoter elements in black on the DNA sense strand Eukaryotic Promoters a. Consensus sequences and positions of promoter elements for protein-encoding genes b. Example: mouse -major globin gene promoter region with promoter elements in black on the DNA sense strand c. Consensus sequences and positions of promoter elements for rRNA genes...
View Full Document

This note was uploaded on 04/15/2008 for the course BIO 325 taught by Professor Saxena during the Spring '08 term at University of Texas at Austin.

Page1 / 3

03Transcription2 - a gatttgctt. .. AAUUGUGAGC. . . mRNA of...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online