Notes - Genetics Notes 1 and downstream relative terms used...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Genetics- Notes- 1 Transcription- Upstream and downstream- relative terms used to describe position on DNA; has to be tied to particular side of particular gene Start of gene= nucleotide where RNA polymerase starts transcribing= +1 nucleotide Everything downstream of that nucleotide= +2, +3, +4, etc. through length of gene Nucleotides upstream of +1=, -1, -2, 3, etc. Conserved sequence= Sequence that you see from gene to gene/ species to species Conservation implies function: if you mutate something that has a function, there’s a negative affect; there must be a reason these sequences are kept Consensus sequence- the ‘mean’ of groups of conserved sequences; typically most functionally version, so any sequence that matches the consensus is expected to bind most strongly. Reduced functionality is seen with changes in single nucleotides. GCTGAT Sometimes you can only say whether it is purine ( R, or Pu) or pyrimidine TCCACT (Y, Py); sometimes you have to say that it just doesn’t matter (there is an GCTAAT unconserved nucleotide in the middle of the sequence), denoted by N GCGAGT GCTGTC . GCTRNT A mutation that causes increase in functionality of a sequence is called an up-mutation; a mutation that causes a decrease in functionality of a sequence is a down-mutation. Consensus sequence is written 5’-3’ with sense strand. - consensus sequence centered on -10, plus or minus a bit The whole sequence, from -35 to +1 is the promoter. You test the function by mutating the sequence. If you mutate the -35 sequence, binding is affected. It’s not important that the -10 and -35 are ten and thirty five nucleotides down from the +1 nucleotide. RNA polymerase initiates transcription 35 and ten nucleotides down from these nucleotides. The part of RNA polymerase that is more functional for binding locates itself at the -35 nucleotide, same for helicase and -10. It lines itself up this way. Start point of the gene is influenced more by the spacing of the sequence than the actual nucleotide. Reason for weak promoter? 1
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
-35 sequence off by one -10 sequence off by two Because difference in – 10 sequence, this is slower to unwind Less transcription-weak promoter DNA 5’ 3’ TTGACA AACTGT TATAAT ATATTA A T ...NNNNNNACCCCAGGC TTTACA CTTTATGCTTCCGGCTCG TATGTT GTGTGG A ATTGTGAGC. .. DNA mRNA A sense strand template strand 5’ 5’ lac  promoter in  E. coli -35 sequence –10 sequence +1 -35 -10 +1 -20 .. taga gccacaccc tggtaag ggccaatct gctcacacaggatagagagggcaggagccagggcagagca tataagg tgaggtaggatcagttgctcctc a gatttgctt. .. AAUUGUGAGC. . . mRNA of  lac  genes sense strand TATAAAA ATATTTT YAY RTR GGCCAATCT CCGGTTAGA GGGCG CCCGC AGAUUUGCUU. .. mRNA 5’ 5’ 3’ GC box CAAT box TATA box +1 sense strand template strand AY 5’ mRNA -25 -75 UPSTREAM CONTROL ELEMENT CORE ELEMENT -150          -100 -50           +1 sense strand template strand rRNA 5’ 5’ 3’ 5’ 5’ Prokaryotic Promoters
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

Page1 / 9

Notes - Genetics Notes 1 and downstream relative terms used...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online