{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

practiceExam4Key - Bio200 W05 Exam#4 Hannele Ruohola-Baker...

Info icon This preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Bio200, W05 Name: ___ KEY versions A & B _______ Exam#4 Hannele Ruohola-Baker TA: ___________________ 1 There is only one correct answer for each question. We do not take away points for incorrect answers. Use a#2 pencil for your answer sheet. ONLY YOUR ANSWER SHEET WILL BE GRADED. Mark ONLY one answer on the answer sheet. Make sure you are using the section of the answer key that begins with #101. __________________________________________________________________________________ CORRECT ANSWERS ARE IN BOLD; answers that were accepted for partial credit but are not strictly correc t are italicized 101. (3pts) Mouse homologue for Eyeless gene can initiate eye formation in Drosophila. This is an example of the following a) A different genetic code in mice and Drosophila . b) Mouse and Drosophila genomes are the same. c) Mouse and Drosophila eyes are similar. d) Eyeless gene shows spatial co-linearity. e) Very early steps in eye formation are the same in mouse and Drosophila. f) Eyeless is a maternal determinant. 102. (3pts) Hox genes are found in Drosophila and mouse. Which of the following do these genes have in common? 103. (3pts) The gel to the right shows the result of a dideoxy sequencing reaction. What is the sequence of the DNA? 104. (3pts) For this sequencing reaction you need A C G T
Image of page 1

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Bio200, W05 Name: ___ KEY versions A & B _______ Exam#4 Hannele Ruohola-Baker TA: ___________________ 2 105. (2pts) What are the differences between the primers used in in vivo replication and in in vitro PCR? a. Nothing, they are both made by Primase b. PCR primers are not part of introns c. The primers in vivo are RNA, in PCR they are DNA d. DNA polymerase makes the primers in in vivo replication e. In PCR the primers are heat stable 106. (3pts) You would like to amplify only the indicated region of the DNA sequence below using PCR. The primers you would synthesize are: 5’ AAATTCCCGTGATGCGGTGCCGTGCTAGGCCCTGAGGGTCAGGTGTT 3’ TTTAAGGGCACTACGCCACGGCACGATCCGGGACTCCCAGTCCACAA
Image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern