practiceExam4 - Bio200, W05 Exam#4 Hannele Ruohola-Baker...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Bio200, W05 Name: _________________________________ Exam#4 Hannele Ruohola-Baker TA: ___________________ 1 There is only one correct answer for each question. We do not take away points for incorrect answers. Use a#2 pencil for your answer sheet. ONLY YOUR ANSWER SHEET WILL BE GRADED. Mark ONLY one answer on the answer sheet. Make sure you are using the section of the answer key that begins with #101. __________________________________________________________________________________ 101. (3points) Mouse homologue for Eyeless gene can initiate eye formation in Drosophila. This is an example of the following a) A different genetic code in mice and Drosophila . b) Mouse and Drosophila genomes are the same. c) Mouse and Drosophila eyes are similar. d) Eyeless gene shows spatial co-linearity. e) Very early steps in eye formation are the same in mouse and Drosophila. f) Eyeless is a maternal determinant. 102. (3points) Hox genes are found in Drosophila and mouse. Which of the following do these genes have in common? a) They are all kinases. b) They are all transcription factors. c) They affect the body plan of the organism. d) They all show atypical polyglutamine stretches in their genome. e) a, c and d f) b and c g) c and d 103. (3points) The gel to the right shows the result of a dideoxy sequencing reaction. What is the sequence of the DNA? The sequence of this piece is a. 5’ CATACGAACGAGTTCCA 3’ b. 5’ CATTTGAGCAAGCATAC 3’ c. 5’ TGGAACTCGTTCGTATC 3’ d. 5’ AGCTATGGCATACGAACGAGTTCCA 3’ e. none of the above 104. (3points) For this sequencing reaction you need a. Reverse transcriptase b. Primase c. 5’OH of the primer d. DNA polymerase e. Restriction enzyme EcoRI f. Ribonucleotides g. a, b, d, f h. b, d, f A C G T
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Bio200, W05 Name: _________________________________ Exam#4 Hannele Ruohola-Baker TA: ___________________ 2 105. (2points) What are the differences between the primers used in in vivo replication and in in vitro PCR? a. Nothing, they are both made by Primase b. PCR primers are not part of introns c. The primers in vivo are RNA, in PCR they are DNA d. DNA polymerase makes the primers in in vivo replication e. In PCR the primers are heat stable 106. (3points) You would like to amplify only the indicated region of the DNA sequence below using PCR. The primers you would synthesize are: 5’ AAATTCCCGTGATGCGGTGCCGTGCTAGGCCCTGAGGGTCAGGTGTT 3’ TTTAAGGGCACTACGCCACGGCACGATCCGGGACTCCCAGTCCACAA a) 5’ GATGCGGTGC 3’ and 5’ CCGGGACTCC 3’ b) 5’ GATGCGGTGC 3’ and 5’ CCTCAGGGCC 3’ c) 5’ CGATCCGGGA 3’ and 5’ CGTGGCGTAG 3’ d) 5’ TCCCGGATCG 3’ and 5’ CTACGCCACG 3’ 107. (3points) You isolated a mutant cell line in which it seems as if G1/S Cdk is always active but Cyclin still oscillates. Which of the following could explain this? a) It is a mutant that lacks E2F
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

This test prep was uploaded on 04/15/2008 for the course BIO 200 taught by Professor Cooper during the Spring '04 term at University of Washington.

Page1 / 8

practiceExam4 - Bio200, W05 Exam#4 Hannele Ruohola-Baker...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online