quiz1 - Label this arrow “transcript.” (e). Show using...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
Genome 371 Spring, 2005 Braun/Pallanck Name: . Quiz 1 A protein with the amino acid sequence Met-Thr-Leu-Asp (reading from amino terminal to C terminal) was produced from a gene residing within the double-stranded DNA molecule shown below. (a). Show the 5’ and 3’ ends for each of the two strands of DNA in the double-stranded DNA molecule shown below. (b). Draw a box around the nucleotide sequence in the CODING STRAND of the DNA molecule shown below that encodes the Met-Thr-Leu-Asp amino acid sequence. (c). Write out the sequence of mRNA that encodes the Met-Thr-Leu-Asp sequence (be sure to label the 5’ and 3’ end of the mRNA molecule). (d). Show using an arrow above the double-stranded DNA molecule shown below the direction of transcription.
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Label this arrow “transcript.” (e). Show using an arrow above the transcript the direction of translation. Label this arrow “translation.” Double-Stranded DNA sequence: TTGTACTGCGACCTAGTCCAAGGTCATCCGTA AACATGACGCTGGATCAGGTTCCAGTAGGCAT . UUU UCU UAU UGU U UUC UCC UAC UGC C UUA UCA UAA UGA A UUG UCG UAG UGG G CUU CCU CAU CGU U CUC CCC CAC CGC C CUA CCA CAA CGA A CUG CCG CAG CGG G AUU ACU AAU AGU U AUC ACC AAC AGC C AUA ACA AAA AGA A AUG ACG AAG AGG G GUU GCU GAU GGU U GUC GCC GAC GGC C GUA GCA GAA GGA A GUG GCG GAG GGG G Phe } } } } } Leu Val Met Ile Leu } Ser } Pro } Thr } Ala Tyr } Stop Stop His } Gln } Asn } Lys } Asp } Glu } Cys } Stop Trp } Arg Ser } Arg } } Gly U U C A G Second letter First letter Third letter C A G...
View Full Document

This test prep was uploaded on 04/15/2008 for the course GENOME 371 taught by Professor Unsure during the Summer '03 term at University of Washington.

Ask a homework question - tutors are online