quiz1 - Label this arrow “transcript.”(e Show using an...

Info icon This preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
Genome 371 Spring, 2005 Braun/Pallanck Name: . Quiz 1 A protein with the amino acid sequence Met-Thr-Leu-Asp (reading from amino terminal to C terminal) was produced from a gene residing within the double-stranded DNA molecule shown below. (a). Show the 5’ and 3’ ends for each of the two strands of DNA in the double-stranded DNA molecule shown below. (b). Draw a box around the nucleotide sequence in the CODING STRAND of the DNA molecule shown below that encodes the Met-Thr-Leu-Asp amino acid sequence. (c). Write out the sequence of mRNA that encodes the Met-Thr-Leu-Asp sequence (be sure to label the 5’ and 3’ end of the mRNA molecule). (d). Show using an arrow above the double-stranded DNA molecule shown below the direction of transcription.
Image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Label this arrow “transcript.” (e). Show using an arrow above the transcript the direction of translation. Label this arrow “translation.” Double-Stranded DNA sequence: TTGTACTGCGACCTAGTCCAAGGTCATCCGTA AACATGACGCTGGATCAGGTTCCAGTAGGCAT . UUU UCU UAU UGU U UUC UCC UAC UGC C UUA UCA UAA UGA A UUG UCG UAG UGG G CUU CCU CAU CGU U CUC CCC CAC CGC C CUA CCA CAA CGA A CUG CCG CAG CGG G AUU ACU AAU AGU U AUC ACC AAC AGC C AUA ACA AAA AGA A AUG ACG AAG AGG G GUU GCU GAU GGU U GUC GCC GAC GGC C GUA GCA GAA GGA A GUG GCG GAG GGG G Phe } } } } } Leu Val Met Ile Leu } Ser } Pro } Thr } Ala Tyr } Stop Stop His } Gln } Asn } Lys } Asp } Glu } Cys } Stop Trp } Arg Ser } Arg } } Gly U U C A G Second letter First letter Third letter C A G...
View Full Document

  • Summer '03
  • Unsure
  • DNA, double-stranded DNA molecule, UCA Ser UCG CCU CCC Pro CCA CCG ACU ACC Thr ACA ACG GCU GCC Ala GCA GCG, Leu CUU CUC Leu CUA CUG AUU AUC Ile AUA

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern