{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

BS9907PS2 - BIO SCI 99 Problem Set#2 1 Heparin is a...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
BIO SCI 99 Problem Set #2 1. Heparin is a polyanion that inhibits RNA transcription in vitro by binding to the β ’ subunit of bacterial RNA polymerase (RNAP). What function of RNAP is heparin interfering with? 2. The 5' end of the coding strand of a prokaryote gene is diagramed below. Answer the following questions based on the sequence information. +1 GACATAAACCCTTTGGGTTGACA(N) 17 GCTATAAT(N) 7 A GTGGGAGGAGCCCGTGGGGACATGGAACCC a. Underline the following sequences: the σ binding site, the pribnow box, the translational start site b. If an additional 10 nucleotides were inserted into the (N) 17 region would you expect RNAP to initiate transcription efficiently at this site? 3. A mutant of E. coli has constitutive expression of β -galactosidase. A partial diploid formed with this mutant and F I + O + Z + has inducible synthesis of β -galactosidase. What is the genotype of the mutant? 4.
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

Page1 / 2

BS9907PS2 - BIO SCI 99 Problem Set#2 1 Heparin is a...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon bookmark
Ask a homework question - tutors are online