Discussion Quiz 7 - 3 Write complementary strand of following strand of DNA 1 Point 5’ 3’ 4 Give the name of following nucleotides also tell

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Full Name: EID: Discussion Section: BIO 325 GENETICS: Quiz # 7 (Wednesday March 26, 2008) 1. Give the name of the following chromosomal mutations: 2 Points 2. Differentiate between the following: 4 Points a. Nondisjuction during meiosis I and meiosis II b. Polyploid and aneuploid c. Autopolyploid and allopolyploid
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
d. Nucleotide and nucleoside
Background image of page 2
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 3. Write complementary strand of following strand of DNA: 1 Point 5’ AATTGGATCTCGAATCACGC 3’ 4. Give the name of following nucleotides; also tell which one is purine and pyrimidine. 2 POINTS 5. If n=8, how many chromosomes will be present in following organisms: 1 Point a. Diploid b. Haploid c. Triploid d. Tetraploid...
View Full Document

This test prep was uploaded on 04/16/2008 for the course BIO 325 taught by Professor Saxena during the Spring '08 term at University of Texas at Austin.

Page1 / 2

Discussion Quiz 7 - 3 Write complementary strand of following strand of DNA 1 Point 5’ 3’ 4 Give the name of following nucleotides also tell

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online