Flow of Genetic Information.doc - The Flow of Genetic...

This preview shows page 1 - 3 out of 3 pages.

The Flow of Genetic InformationComplete the following exercise.1.Replicate the following DNA nucleotide sequence:TACAAAAGTGTGTCTACACGCCACTGAGACATACGATTCCCAACTATG TTT TCA CAC AGA TGT GCG GTG ACT CTG TAT GCT AAGGGT TGA2.Transcribe the template sequence.AUG UUU UCA CAC AGA UGU GCG GUG ACU CUG UAU GCU AAGGGU UGA3.Translate the transcript (you must use the Genetic Code).
Met-Phe-Ser-His-Arg-Cys-Ala-Val-Thr-Leu-Tyr-Ala-Lys-Gly-StopRNA Processing1.List the steps of mRNA processing in eukaryotes.
End of preview. Want to read all 3 pages?

Upload your study docs or become a

Course Hero member to access this document

Term
Summer
Professor
NoProfessor
Tags
DNA, RNA, genetic information

  • Left Quote Icon

    Student Picture

  • Left Quote Icon

    Student Picture

  • Left Quote Icon

    Student Picture