Molecular Evolution - Gene 3000 Molecular Evolution...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Gene 3000 02-20-07 Molecular Evolution (cont’d) Repeated DNA (DNA families) ACGTACGTACGTACGTACGTACGTACGT (repeated sequence) This sequence could be located on one chromosome or on multiple chromosomes “Conserted Evolution” – pattern of evolution that repeated DNA goes through o Overall, mechanisms cause the three processes to interact with one another (1) How does copy number evolve? (more or less repeated sequences) (2) How are copies moved from one location to another in the genome? (3) What are the mechanisms that operate to keep copies in a family similar? (1) Amplification (2) Distribution (3) Homogenization 1
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Gene 3000 02-20-07 o Amplification (or de-amplification) Two mechanisms Unequal crossing over Transposition (for most genes/repeated sequences) o Distribution Transposition o Homogenization Homogenization – even in non-genic regions, mutations are not accumulated as would normally be expected (under no selection) – meaning there are fewer mutations than would be expected
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 4

Molecular Evolution - Gene 3000 Molecular Evolution...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online