6 - UNIVERSITY OF TORONTO Faculty of Arts and Science April...

Info icon This preview shows pages 1–14. Sign up to view the full content.

Image of page 1

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

Image of page 2
Image of page 3

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

Image of page 4
Image of page 5

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

Image of page 6
Image of page 7

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

Image of page 8
Image of page 9

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

Image of page 10
Image of page 11

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

Image of page 12
Image of page 13

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

Image of page 14
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: UNIVERSITY OF TORONTO Faculty of Arts and Science April Final Exam Thursday, April 16‘“, 2015 BIOl30HIS From 7:00-9:00 pm DURATION: 2 hours No Test Aids Allowed Number of pages: 11 (not including this one) Number of questions: 53 multiple choice This final exam is worth 40% of your final mark. INSTRUCTIONS: Please read carefully! 1. All questions are based on the lecture material of Section 2 and labs 1-4 (pre-lab of lab 4 only). You are to choose the BEST answer; there is ONE and only one correct answer per question (multiple answers for a question will be marked wrong). There is no additional penalty for incorrect answers, so do NOT leave any questions unanswered (blank) on your answer sheet. Write your name on your test question paper. 2. Green Computer Answer Sheet: SCANTRON (See sample on the back of this page) Transfer your answers to the computer scantron answer sheet using a soft lead pencil and darken inside one box ONLY as multiple answers will be marked wrong. Erase all corrections completely. ONLY your answer sheet will be marked. On the left side of your computer answer sheet: a) Print your last name in the boxes provided, and darken the appropriate letters in each column. Print your first name initial(s) in the far right columns and darken the appropriate letters. b) Print your student number and carefully darken the appropriate numbers. Do not leave this section blank. If you have a 9-digit student number, please add a ‘0’ at the beginning of your student number and then fill in your 9 digit student number. c) Print the exam version in "CODE" and darken in the appropriate numbers. The test version is at the bottom of every page of this test. Hand in BOTH your COMPUTER ANSWER SHEET and your Test PAPER TEST VERSION 44 u__m_-_~——n——-_.~_——uu_u ......... wwwévmawawuunfiw L. ft», ,,,,, in ‘. wigmxggi: mmfimgfi; :1: m i) wmm a w¢fimx$ "5% a, {E (3?: fit W mem .ngmfii we mfim “m . 1 a zfimfifig man rm. .~ mmmgmfi waxy. @wfiw ommfi a £3 muqu mm 33 a w nwmmhngw .Awmammww mam figam mm fimafiflfiwxw a Emmymmw ,3 mmfimwwm m Swémfi,__a<fi§ w 2.6m FOE; , amame 1. What interactions provide structure for the plasma membrane? a. Membrane proteins organise the lipids in the bilayer through interactions between amino acid side chains. b. Lipids organise the membrane proteins on the surface of the bilayer through interactions between lipid hydrocarbon tails and water. c. Hydrophobic lipids provide the basic structure of the membrane through interactions with water. Cl. Amphipathic lipids provide the basic structure of the membrane through interactions with water. 2. Which location will have the FEWEST number of phosphatidylcholine molecules? The exoplasmic face of the Golgi apparatus. The side of the plasma membrane facing the outside of the cell. The endoplasmic reticulum membrane leaflet facing the lumen. The cytosolic face of vesicle membranes. 9.0375» 3. Which of the following proteins MOST likely corresponds to the hydropathy plot shown below? (“START” refers to an ER signal sequence which is a start transfer sequence. “++" refers to a positively charged II [I amino acid region, -- refers to a negatively charged amino acid region.) 0 so 1 MOWW_ a. NH: START C00“ b. NHzSTART coon c- ~H2<=00H d. None of the above. 4. Which of the following statements BEST describes the structure of most membrane spanning domains in the integral membrane proteins of eukaryotic cells? A rolled up beta~sheet of 20-30 amino acids with mainly hydrophobic side chains. An alpha-helix of 20-30 amino acids with mainly hydrophobic side chains. An amphipathic alpha-helix of 20—30 amino acids. - A rolled up beta-sheet of 20-30 amino acids with mainly hydrophobic side chains in contact with membrane lipids and hydrophilic side chains lining the pore. $19.69: VERSION 44 Page 1 of 11 5. In the laboratory you are observing the effect of temperature on membrane phospholipids. You conduct an experiment in which you incubate the same type of bacteria at two different temperatures. Sample 1 was incubated at 20 '0. Sample 2 was incubated at 40 'C. What do you expect to find when you compare the phospholipids from each sample? Sample 1 will have more saturated phospholipids that also contain shorter hydrocarbon tails. Sample 1 will have more unsaturated phospholipids that also contain longer hydrocarbon tails. Sample 2 will have more unsaturated phospholipids that also contain shorter hydrocarbon tails. Sample 2 will have more saturated phospholipids that also contain longer hydrocarbon tails. 9.0.69: 6. Which of the following corresponds to the CORRECT order from most hydrophilic to least hydrophilic? a. A GPl-anchored protein; a single pass transmembrane protein; a mature secreted protein; the Na+lK+ pump. _ b. The Na+lK+ pump; a GPl-anchored protein; a single pass transmembrane protein; a mature secreted protein. c. A mature secreted protein; a GPl-anchored protein; a single pass transmembrane protein; the Na+lK+ pump. cl. A GPl-anchored protein; a single pass transmembrane protein; the Na+lK+ pump; a mature secreted protein. ‘ 7. Which of the following statements concerning transport proteins is CORRECT? All transport proteins bind to solutes and exhibit a dramatic conformational change during transport. All active transport proteins require ATP. All channel proteins perform facilitated diffusion. All transporter proteins perform active transport. 999's» 8. You are manipulating transport proteins in a Na+-filled artificial liposome. There is a supply of H+, ADP, and P; outside of the liposome. Which of the following would result in the generation of the largest amounts of ATP? 3. A Na+IH+ exchanger that transports Na+ out of the lipsome and an F-type ATPase with its ATP binding domain facing the outside of the liposome. b. A Na+/H+ exchanger that transports Na+ out of the lipsome and an ABC transporter with its ATP binding domain facing the outside of the liposome. c. A Na+/H+ symporter that transports Na+ into the lipsome and a V-type ATPase with its ATP binding domain facing the outside of the liposome. d. A Na+/H+ symporter that transports Na+ out of the lipsome and an F-type ATPase with its ATP binding domain facing the outside of the liposome. 9. Which of the following is a similarity between actin filaments and microtubules? They both have polarity. They both hydrolyze ATP. They are both made up of heterodimers. They are both anchored on centrosomes. 9933'!” VERSION 44 Page 2 of 11 10. Which of the following scenarios would you expect to disrupt the transport of glucose from the lumen of the intestine to the blood stream? a. A higher concentration glucose in the cytosol of intestinal epithelial cells compared with the blood stream. b. Increased activity of the Na+/K+ pump at the basolateral membrane of the intestinal epithelial cells. 0. K+ leak channels in the basolateral membrane of intestinal epithelial cells. d. A lower concentration of Na+ in the lumen of the intestine compared to the cytosol of intestinal epithelial cells. 11. Which two proteins have the greatest role in establishing the resting membrane potential of animal cell plasma membranes? a. Na+/K+ pump and K+ leak channels. b. K+ co-transporters and the Na+lK+ pump. 0. Na+ co-transporters and Na+ leak channels. d. The V-type ATPase and H+ co-transporters. 12. Which of the following mutations would you expect to affect transmission of a signal across a nerve synapse? A mutation in voltage gated Ca2+ channels. A mutation in kinesin. A mutation in acetylcholine receptors. All of the above. 9.025;» 13. Acid hydrolases in the lumen of the lysosome break down proteins into individual amino acids. These proteases require the acidic environment in the lysosome lumen. Amino acids generated in the lysosome lumen must be transported across the lysosome membrane into the cytosol. You measure the concentration of amino acids in the cytosol and discover that this concentration is five times higher than the concentration in the lumen of the lysosome. Which of the following proteins is MOST likely to be responsible for transporting amino acids out of the lysosome? a. An amino acid channel b. An amino acid uniporter c. A H‘lamino acid antiporter d. A H*Iamino acid symporter 14. Pancreatic cells have been treated with a translation initiation inhibitor. After 30 min (when all previous translation has been completed), where would the majority of the ribosomes be located? Golgi only. RER and cytosol. RER only. Cytosol only. 9.0.65» VERSION 44 Page 3 of 11 15. Which of the following describes the likely movement of a protein, from the start of translation to its final destination? $1.0 .65» 16. nucleus, cytosol, endoplasmic reticulum, Golgi apparatus, lysosomes, outside of the cell. cytosol, endoplasmic reticulum, peroxisome. endoplasmic reticulum, Golgi apparatus, mitochondrion. cytosol, nucleus. ' If the signal sequence of an extracellular matrix protein is mutated which of the following would be MOST likely to occur? a. b. 17. The protein would remain in the cytosol and would be larger than the protein secreted from normal cells. The protein would remain in the cytosol and would be smaller than the protein secreted from normal cells. The protein would remain associated with the translocon and would be smaller than the protein secreted from normal cells. The protein would remain associated with the translocon and would be larger than the protein secreted from normal cells. You design an experiment that allows you to label newly synthesized lipids and trace their path through the cell. Which of the following movements of labelled lipids are you MOST likely to observe? a. b. 18. Label at the rough endoplasmic reticulum followed by the Golgi apparatus and then secretory vesicles. Label at the plasma membrane followed by early endosomes and then the smooth endoplasmic reticulum. Label at the smooth endoplasmic reticulum followed by the Golgi apparatus and then secretory vesicles. Label at the plasma membrane followed by early endosomes and then the rough endoplasmic reticulum. Immediately after the process of endocytosis, glycosylated lipids in the exoplasmic leaflet will be found to have their glycosylated hydrophobic head groups facing the lysosome lumen. their glycosylated polar head groups facing the early endosome lumen. their glycosylated polar head groups facing the cytosol. ’ their glycosylated hydrophobic tails facing the cytosol. 19. How are intermediate filaments different from microtubules? a. b. c. d. VERSION 44 Only intermediate filaments hydrolyze a nucleoside triphosphate. Only intermediate filaments have motor proteins. Only intermediate filaments are absent from plant cells. Only intermediate filaments form dimers. Page 4 of 11 20. A protein transmembrane segment is found to have a more negative charge towards the amino-terminal end of the protein and a more positive charge towards the carboxy-terminal end of the protein. Which of the following statements is MOST likely to be true for this protein? a. If the protein is a plasma membrane receptor, the carboxy—terminal end will be found in the extracellular environment. b. If the protein is an acid hydrolase, it will be found in the late endosome membrane with its amino- terminal end glycosylated. c. if the protein is resident in the endoplasmic reticulum membrane, the amino-terminal end will be found in the cytosol. _ cl. If the protein is a V-type ATPase, it will be found in the lysosome lumen. 21. In animal cells, microtubules are continually growing and shrinking due to a. dynamic instability at the minus end b. dynamic instability at the plus end o. the interactions of actin and myosin d. All of the above 22. Which of the following proteins would be MOST likely to carry a collagen filled vesicle from the Golgi apparatus towards the plasma membrane? a. Kinesin b. Actin c. Dynein d. Myosin 23. Which of the following proteins would be MOST likely to aid in the transfer of vesicles from the endoplasmic reticulum to the Golgi apparatus? a. Kinesin b. Actin c. Dynein d. Myosin 24. Which of the following techniques would you use if you wanted to investigate the organization of individual microtubules in the cilia of a paramecium? a. Fluorescence recovery after photobleaching b. Electron microscopy c. Immunofluorescence and light microscopy d. A pulse chase experiment 25. Which of the following best describes a structure and its subunits? a. Cell walls are composed of intermediate filaments. b. Plasmodesmata are composed of phospholipids. c. Adhesion belts are composed of claudins and occludins. d. Sealing strands are composed of cadherins. VERSION 44 Page 5 of 11 26. Two Cells are linked by a single gap junction. How many transmembrane domains make up this link? 48 24 12 6 51.0575» 27. Your research has determined that a gastrointestinal disease is caused by the failure of intestinal epithelial cells to locate transport proteins to the apical membrane within the cell. Which of the following two genes would be MOST likely to contain a mutation? Genes coding for.... occludin and a gap junction protein. integrin and a microfilament motor protein. plectin and laminin. claudin and a microtubule motor protein. 9-9.5!” 28. Connective tissues are held together by the interaction between cells and the extracellular matrix. gap junctions. tight junctions. desmosomes. 5199's» 29. Which of the following is NOT involved in providing mechanical strength to an epithelial sheet? The interaction between cells and the extracellular matrix. Gap junctions. Tight junctions. Desmosomes. 9.0.6.!» 30. Which of the following statements is TRUE with respect to the extracellular matrix? a. After the extracellular matrix has formed the components are never removed. b. Laminins in the extracellular matrix are not glycosylated. c d Proteoglycans in the extracellular matrix exclude water due to their hydrophobic nature. . All proteoglycans are glycoproteins. ‘ 31. Which of the following research projects has the GREATEST chance of success? a. Elucidating the steps involved in initiating DNA replication at the beginning of M phase. b. Elucidating the steps in activating condensin proteins at the beginning of M phase. c. Elucidating the steps involved in dephosphorylating lamins at the beginning of M phase. d. Elucidating the steps involved in centrosome fusion at the beginning of M phase. VERSION 44 Page 6 of 11 32. 33. 34. 35. 36. 37. VERSION 44 Which of the following statements is CORRECT? a. Assembly of the mitotic spindle requires GTP and not ATP. b. Centriole replication is considered conservative. 0. During M phase, a normal cell may have up to 4 centrioles. d. y-tubulin anchors microtubules by binding directly to B—tubulin. Different checkpoints control progression through the cell cycle. Which checkpoint ensures that all chromosomes are properly attached to the spindle assembly before cell cycle progression? a. The metaphase to anaphase transition. b. The start checkpoint. c. The GZIM transition. d. The prometaphase to metaphase transition. Which of the following processes do NOT require ATP in animal cells? a. Mitotic spindle assembly. b. Cytokinesis. c. The movement of sister chromatids towards opposite poles of the spindle apparatus during anaphase. d. Aligning chromosomes on the metaphase plate. Which of the following corresponds to the correct order of events during the cell cycle? a. DNA replication; The start checkpoint; The metaphase to anaphase transition; Cytoklnesis. b. Mitotic spindle assembly is completed; Nuclear envelope breakdown; Chromosomes align on the metaphase plate; Cytokinesis. The GZ/M transition; DNA replication; M phase; G1. DNA replication; Nuclear envelope breakdown; Mitotic spindle assembly is completed; The metaphase to anaphase transition. 9-9 Which of the following cells are NOT in G0 under normal conditions? a. Neurons b. Red blood cells c. Muscle cells d. Epithelial stem cells Which of the following MOST likely describes a protein that will become a voltage gated ion channel? A protein containing an N-terminal signal sequence. A protein containing only one internal signal sequence. A protein containing more than one internal signal sequence. A protein without any signal sequence. 99'!“ $1 Page 7 of 11 38. You are observing an actin filament in vitro in a solution of actin monomers that has a concentration below ’ the treadmilling concentration range. You give a short pulse of GFP-labelled actin monomers followed by a chase with unlabelled actin monomers. What do you observe in the actin filament? A band of fluorescence that travels from the plus end of the filament to the minus end. A fluorescent band appears at both the plus and minus ends; the band is larger at the plus end. Over time the entire filament becomes fluorescent. You do not observe any fluorescence in the filament. 31.0279 39. The basement membrane structure is organized by a. laminin interacting with integrin in the plasma membrane at hemidesmosomes. b. collagen interacting with integrin in the plasma membrane at the adhesion belt. c laminin interacting with integrin in the plasma membrane at desmosomes. d. fibronectin interacting with integrin in the plasma membrane at desmosomes. 40. Which of the following would you expect to prevent assembly of the mitotic spindle? An inactivating mutation in... a. cofilin. b. the ATPase domain of myosin. c. the ATPase domain of kinesin. d. Both B and C would be expected. 41. Why is SDS often used together with Proteinase K during DNA extractions? SDS chelates magnesium ions so that Proteinase K can work more efficiently. Proteinase K and SDS are more efficient when used at room temperature. SDS unfolds proteins so that peptide bonds are more accessible to Proteinase K. SDS removes histones and improves the ionic interactions between Proteinase K and the DNA backbone. 9.0.69 42. Which of the following will have the GREATEST effect on the migration rate of DNA fragments in a DNA sample during agarose gel electrophoresis? . Whether the DNA came from a prokaryote or a eukaryote. . Whether a DNA ladder is loaded or not. a b c. The length of the DNA fragments in the DNA sample. d. The volume of sample loaded into the gel. 43. If you were going to make a 1% agarose gel and knew that you needed a final volume of 50 mL, how much agarose would you need? 1.0 grams 0.5 grams 0.2 grams 0.1 grams 9.0.69: VERSION 44 Page 8 of 11 44. You are given a DNA sequence from a sample of retinal tissue. You BLAST the sequence and part of the BLAST result is shown below. >gb|M92036.1[GECP521A Gecko gecko green sensitive visual pigment (P521) mRNA, complete cds Length=2118 Score = 398 bits (215), Expect Identities = 570/737 (77%), Gaps Strand=Plus/P1us 2e-107 42/737 (5%) [I ll Query 7 CCCGTTT—GAAGGTCCAAATTATCATATTGCACCACGATGGGTCTACAACATAACT-TCA 64 III III llllllllill lllll lllilllllil lllll llllll I I ll Sbjct 177 CCC-TTTCGAAGGTCCAAACTATCACATTGCACCACGGTGGGTGTACAAC-TTGGTCTCT 234 Query 646 CCAGCAGAAAGAGTCTGAATCAACACAGAAGGCTGAGAAGGAAGTGTCAAGAATGGTAGT 705 llililllilll ll H H H llllllll llll ill Hill llllllll ll Sbjct 816 CCAGCAGAAAGAATCCGAGTCCACGCAGAAGGCCGAGAGGGAGGTGTCCAGAATGGTGGT 875 Based on the results shown above, you are SURE that (choose the BEST answer): the sequence you have been given is identical to the one from Gecko gecko (GECP521A). the Gecko gecko sequence is 2118 nucleotides long. the Gecko gecko sequence is 737 nucleotides long. given the size of the database, it is highly likely that matches as good as this one could be found by chance. 9.0.693 45. Which of the following is a CORRECT function of loading dye in electrophoresis? a. It is used to estimate the length of time that you should perform the electrophoresis. b. it is used to stain the bases in your DNA sample. c. it is used to create a calibration curve to estimate the mobility of particular DNA fragments. d. it neutralizes the overall negative charge of the DNA backbone. 46. How much 5X PCR buffer do ...
View Full Document

  • Fall '15

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern