AnswerKeyExam2 - Biol 3301: Genetics Exam #2 November 1,...

Info iconThis preview shows pages 1–6. Sign up to view the full content.

View Full Document Right Arrow Icon
Biol 3301: Genetics Exam #2 November 1, 2005 This exam consists of 50 questions worth a total of 100 points. All questions are  multiple-choice.  Each question has only ONE answer so choose the best answer.  The  Genetic Code Table is on the last page. Good luck! Please use the LAST FIVE DIGITS OF YOUR ID # Name_________________________ID#_____________________
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Question 1-9: Shown below (1-7) are locations of mutations in a gene which is responsible for cystic  fibrosis. mRNA Protein 1 The specific change at the DNA sequence level underlying each of the 7 mutations is  underlined below. 1. TA TAAT Changed to TC TAAT 2. AT A Changed to AG A Gene 2 4 3 7 6 5 Promoter
Background image of page 2
3. GT G Changed to GG 4. CAA Changed to CAG 5. C GU Changed to T GU 6. A GA Changed to T GA 7. UAC Changed to UAG C 1. Which of the following is/are a transition mutation(s)? -b a. Mutation 7 b. Mutations 4 and 5 c. Mutation 3  d. Mutations 1, 2 and 6 e. Mutations 1, 2, 5 and 7 2. Which of the following is/are a transversion mutation(s)? -d a. Mutation 7 b. Mutations 4 and 5 c. Mutation 3  d. Mutations 1, 2 and 6 e. Mutations 1, 2, 5 and 7 3. Which of the following mutation(s) is/are likely to cause a splicing defect(s)? - c a. Mutation 7 b. Mutations 4 and 5 c. Mutation 3  d. Mutations 1, 2 and 6 e. Mutations 1, 2, 5 and 7 4. Which of the following is/are an example of a synonymous (silent) mutation(s)? - b a. Mutations 1 and 5 b. Mutation 4 c. Mutations 5 and 2 d. Mutation 7 e. Mutations 3 and 6
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
5. Which of the following mutations is/are likely to affect the size of the protein (# of  amino acids)? - e a. Mutations 1 and 5 b. Mutation 4 c. Mutations 5 and 2 d. Mutations 3, 6 and 7 e. Mutations 3 and 6 6. Which of the following mutations is likely to affect the levels or rates of transcription? -  a a. Mutation 1 b. Mutation 2 c. Mutation 4 d. Mutation 6 e. Mutation 7 7. Which of the following sequence(s) does mutation #2 change? - d a. pre-mRNA sequence b. mRNA sequence c. amino acid sequence d. a and b e. All of the above 8. Which of the following sequence(s) does mutation #5 change? - a a. pre-mRNA sequence b. mRNA sequence c. amino acid sequence d. a and b e. All of the above 9. Which of the following sequence(s) does mutation #6 change? - e a. pre-mRNA sequence b. mRNA sequence c. amino acid sequence d. a and b e. All of the above Questions 10-13: The mRNA sequence of a gene is shown below
Background image of page 4
Wild type:  5’ CCAGCAUAUGCCUAAUCGCAGUUCGGAAUAGCAAGCC 3’ Mutation 1:  5’ CCAGCAAUG CC UAAUCGCAGUUCGGAAUAGCAAGCC 3’ (Deletion of  CC ) Mutant 1:  5’ CCAGCAAUGUAAUCGCAGUUCGGAAUAGCAAGCC 3’ Mutation 2:  5’ CCAGCAUAUGCCUAAUCGCAGUU
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 6
This is the end of the preview. Sign up to access the rest of the document.

This test prep was uploaded on 04/19/2008 for the course BIOL 3301 taught by Professor Gunaratne during the Fall '05 term at University of Houston.

Page1 / 18

AnswerKeyExam2 - Biol 3301: Genetics Exam #2 November 1,...

This preview shows document pages 1 - 6. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online