Exam2_Key - Biol 3301 Genetics Exam#2 This exam consists of...

Info iconThis preview shows pages 1–5. Sign up to view the full content.

View Full Document Right Arrow Icon
Biol 3301: Genetics Exam #2 October 25, 2004 This exam consists of 50 questions worth a total of 100 points. All questions are multiple-choice. Each question has only ONE answer so choose the best answer. There are a total of 12 pages in this exam. The Genetic Code Table is on page 11. The last page is blank. Good luck. Name_________________________SS#____________________ _ 1
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Questions 1-8: Given below is the mRNA sequence of a gene 5’AGGAUAAAUGGACCAUUG C UGGGAC CUGAGUUA ACGAUGUACCAUAGUUACUGAUG 3’ Use the five choices below to answer questions 1 and 2 a. 5’ UGGACCAUUGCUGGGAC 3’ b. 5’ TGGACCATTGCTGGGAC 3’ c. 5’ ACCTCCTAACGACCCTG 3’ d. 3’ CAGGGUCGUUACCAGGU 5’ e. 5’ GTCCCAGCAATGGTCCA 3’ 1. This is a portion of the DNA sequence of the template strand. e 2. This is a portion of the DNA sequence the coding strand. b Use the five choices below to answer questions 3-7 a. 2 b. 8 c. 12 d. 8 and 5 e. 6 3. If the mRNA is eukaryotic how many amino acids will the protein, which is translated from this mRNA contain? b 4. If the mRNA is prokaryotic how many different proteins can this mRNA be translated into? a 5. How many amino acids represent the prokaryotic protein(s)? d 6. A deletion of the A base in the position denoted by the arrow #1 will cause the reading frame to shift. If this is a eukaryotic mRNA how many amino acids will the mutant protein contain? c 7. A deletion of base C denoted by arrow #2 caused a premature termination of translation. If this is a eukaryotic mRNA how many amino acids will the mutant protein contain? e Use the five choices (a-e) below to answer question 8 a. Cys b. Ser c. Trp d. Cys and Trp e. Trp and Ser 2 #1 #2
Background image of page 2
8. Which tRNA will be able to suppress this mutation to give back the original protein by a single base deletion in its anticodon (Consult the genetic code table in page 10)? a Questions 9-16 The following is a diagram of the replication machinery. Use the choices (a-e) below to answer questions 9-13 a. Leading strand b. Lagging strand c. Okazaki fragment d. RNA primer e. Replication fork 3 10 13 14 12 15 11 3’ 5’ 16
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
9. What is the name of this structure, which is of central importance in DNA replication? e 10. What is this element called?
Background image of page 4
Image of page 5
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 04/19/2008 for the course BIOL 3301 taught by Professor Gunaratne during the Fall '05 term at University of Houston.

Page1 / 12

Exam2_Key - Biol 3301 Genetics Exam#2 This exam consists of...

This preview shows document pages 1 - 5. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online