Exam2_Key - Biol 3301 Genetics Exam#2 This exam consists of...

Info icon This preview shows pages 1–4. Sign up to view the full content.

View Full Document Right Arrow Icon
Biol 3301: Genetics Exam #2 October 25, 2004 This exam consists of 50 questions worth a total of 100 points. All questions are multiple-choice. Each question has only ONE answer so choose the best answer. There are a total of 12 pages in this exam. The Genetic Code Table is on page 11. The last page is blank. Good luck. Name_________________________SS#____________________ _ 1
Image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Questions 1-8: Given below is the mRNA sequence of a gene 5’AGGAUAAAUGGACCAUUG C UGGGAC CUGAGUUA ACGAUGUACCAUAGUUACUGAUG 3’ Use the five choices below to answer questions 1 and 2 a. 5’ UGGACCAUUGCUGGGAC 3’ b. 5’ TGGACCATTGCTGGGAC 3’ c. 5’ ACCTCCTAACGACCCTG 3’ d. 3’ CAGGGUCGUUACCAGGU 5’ e. 5’ GTCCCAGCAATGGTCCA 3’ 1. This is a portion of the DNA sequence of the template strand. e 2. This is a portion of the DNA sequence the coding strand. b Use the five choices below to answer questions 3-7 3. If the mRNA is eukaryotic how many amino acids will the protein, which is translated from this mRNA contain? b 4. If the mRNA is prokaryotic how many different proteins can this mRNA be translated into? a 5. How many amino acids represent the prokaryotic protein(s)? d 6. A deletion of the A base in the position denoted by the arrow #1 will cause the reading frame to shift. If this is a eukaryotic mRNA how many amino acids will the mutant protein contain? c 7. A deletion of base C denoted by arrow #2 caused a premature termination of translation. If this is a eukaryotic mRNA how many amino acids will the mutant protein contain? e Use the five choices (a-e) below to answer question 8 2 #1 #2
Image of page 2
Image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 4
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern