Evidence from Biochemistry Lecture - Evidence from Biochemistry What is a Gene 1866 Mendel = Traits are determined by particles(factors that are passed

Evidence from Biochemistry Lecture - Evidence from...

This preview shows page 1 out of 31 pages.

You've reached the end of your free preview.

Want to read all 31 pages?

Unformatted text preview: Evidence from Biochemistry What is a Gene? 1866 Mendel = Traits are determined by particles (factors) that are passed from one generation to the next. 1909 Danish Botanist Wilhelm Johanssen – Coins word “gene” for the unit associated with an inherited trait What is a Gene? 1910 Thomas Morgan work on fruit flies shows that genes sit on chromosomes 1941 George Beadle & Edward Tatum introduce idea that “One gene makes one enzyme.” What is a Gene? 1944 Avery, MacLeod & McCarty find – Genes are made of DNA 1953 Watson & Crick publish structure of DNA Genes Are Composed of Nucleic Acids (DNA) Double Helix Model Watson & Crick 1953 Base units: Guanine = G Cytosine = C Adenine = A Thymine = T Double Helix Model Two strands of DNA connected together by hydrogen bonds between the base units Guanine = G Cytosine= C Adenine = A Thymine = T Two basic questions about DNA How does it make copies of itself before cell division? How does it control the cell? Video Clip DNA Replication When cells divide they must make a copy of the DNA sequence. Suppose the double helix reads this way: GGCTCAAATGTTAAAAGGTCATGGACCGT AT.. CCGAGTTTACAAT TTT CCAGTACCTGGCATA DNA Replication First the strands unzip GGCTCAAATGTTAAAAGGTCATGGACCGT AT.. CCGAGTTTACAAT TTT DNA Replication Then each separate strand makes a complementary copy of itself. GGCTCAAATGTTAAAAGGTCATGGACCGT AT...CCGA G DNA Replication We end up with two duplicate double strands CCGAGTTT ACAATTTTCCAGTACCT GGCATA….. GGCTCAAATGTTAAAAGGTCATGGACCGTAT …… GGCTCAAATGTTAAAAGGTCATGGACCGTA T… CCGAGTTT ACAATTTTCCAGTACCT GGCATA… How does DNA control the cell? How does DNA control the cell? Central Dogma of Molecular Biology c s an io t r ip Tr n la s n a Tr n o ti In ip r c s n a Tr e h t n o i t la s n a Tr nu s u cle ’s m e s th pla es In to om cy os rib n o ti Instructions from the DNA mRNA tRNA Amino acids as raw material Links amino acids together to make protein The Code ????????? A set of nucleotide bases determines which amino acid will be used to put into the protein. Triplets & Codons How many bases are needed to code for 20 amino acids? (There are only 4 to use) How about 2? 42 = only 16. Not enough How about 3 bases? 43 = 64 DNA triplets More than enough. But we only need 20 different DNA triplets ! Or 20 RNA codons RNA Codons What will be a DNA code for aspartic acid? DNA CTA or CTG mRNA GAU or GAC Amino Acid Asparic acid RNA Codons Several codons code for the same amino acid e.g. phenylalanine is coded by: UUU UUC e.g. leucine is coded by: UUA UUG CUU CUC CUA CUG RNA Codons The same messenger RNA codons are used in virtually all organisms ! What is a Gene? A gene is a sequence of nucleotide bases that code for a polypeptide. CTCAAATGTTAAAAGGTCATGGACCGTAT……. The order of the nucleotide bases determines which amino acid is put into the polypeptide. Protein Analysis Amino Acid sequencing e.g. Cytochrome C enzyme (104 amino acids) Human vs. rhesus monkey 1 difference Human vs. dog 11 differences Human vs. rattlesnake 14 differences Human vs. bullfrog 18 differences Human vs. tuna fish 21 differences Human vs. fruit fly 29 differences Human vs. pumpkin 36 differences Human vs. bacteria 56 differences Nucleic Acid Sequencing (DNA & RNA) Ultimate method Can compare protein coding regions or non-coding. Can analyze nuclear or non-nuclear (mitochondria, chloroplasts or plastids) Complete genome sequences now known for some viruses, s. bacteria, a nematode worm, rat, chimpanzee, and humans. NEXT TIME ...
View Full Document

  • Left Quote Icon

    Student Picture

  • Left Quote Icon

    Student Picture

  • Left Quote Icon

    Student Picture

Stuck? We have tutors online 24/7 who can help you get unstuck.
A+ icon
Ask Expert Tutors You can ask You can ask You can ask (will expire )
Answers in as fast as 15 minutes