05Translation - Translation Overview amino acids codons...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Translation Overview amino acids codons peptide bond polarity amino vs. carboxy end tRNA anatomy 3 stem anticodon arm T C arm D arm The genetic code start codon stop codons degeneracy near universality Wobble rules effect Ribosome anatomy rRNAs ribosomal proteins ribosomal subunits Prokaryotic translation initiation elongation o termination 8 5 3 NH O H HN O N N N (3 tRNA 5) anticodon codon (5 mRNA 3) N N N H H NH 2 O H N N anticodon N N O O codon N N H HN N O O anticodon N N H N N N H codon O H N N N N codon O O anticodon N N H NH 2 anticodon O H N N N N HN O N N H codon anticodon O H N N N N O O codon N N H anticodon O H N N N N HN N N N N H codon UAGGAGGUGCGCAAAUGGGACUCUUUUAGGGCUCACAUUAGCG 5 3 A C A A U CC UG GA A met gly leu phe N C mRNA tRNAs amino acids O C N C C OH H H O H (CH 2 ) 2 CH 3 S H N C C N C C OH H N C C OH...
View Full Document

This note was uploaded on 04/22/2008 for the course BIO 325 taught by Professor Saxena during the Spring '08 term at University of Texas at Austin.

Page1 / 2

05Translation - Translation Overview amino acids codons...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online