02Replic - Replication AAGCGGTCA Semiconservative model of...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Replication Semiconservative model of DNA replication semiconservative replication conservative replication Replication in E. coli , geneticists’ favorite prokaryote origin DnaA box, DnaA AT-rich region helicase terms for strand separation primase DNA polymerase III processivity beta clamp leading strand lagging strand Okazaki fragment DNA polymerase I ligase replisome bidirectional theta structure Replication in mammals DNA polymerase α DNA polymerase δ Figure next page telomere telomerase germ cells vs. somatic cells vs. cancer cells Other replication strategies mitochondria 2 AAGCGGTCA AAGCGGTCA TTCGCCAGT AAGCGGTCA TTCGCCAGT AAGCGGTCA TTCGCCAGT TTCGCCAGT AAGCGGTCA TTCGCCAGT AAGCGGTCA TTCGCCAGT AAGCGGTCA TTCGCCAGT
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
3 AAGGCACGCGTTTAACGTGAGATTCAGCCGAGATTTAATGCGGACGAATTCATTGTGAGCGGATAACAAT AA AAC GTGAGAT UCA GCCGAGATTTAATGCGGACGAATTCATTGTGAGCGGATAACAA TCCGTGCGCAAATTGCACTCTAAGTCGGCTCTAAATTACGCCTG CUU AAGTAAC ACU UA ATAAGGCACGCGTTTAACGTGAGATTCAGCCGAGATTTAATGCGGACGAATTCATTGTGAGCGGATAACAATTT
Background image of page 2
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 04/22/2008 for the course BIO 325 taught by Professor Saxena during the Spring '08 term at University of Texas at Austin.

Page1 / 2

02Replic - Replication AAGCGGTCA Semiconservative model of...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online