10DNATech - DNA Technology How do we manipulate DNA to do...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
DNA Technology How do we manipulate DNA to do what we want it to do, both for analysis and for practical application? Restriction enzymes restriction endonuclease restriction site palindrome cut EcoRI GAATTC EcoRV GATATC Sau3AI GATC CTTAAG CTATAG CTAG -NNG AATTCNN- -NNGAT ATCNN- -NN GATCNN- -NNCTTAA GNN- -NNCTA TAGNN- -NNCTAG NN- restriction fragments sticky ends methylation CCCTACCATCGGCGAATTCGGAGATATCGGGAAATTCGTATGGACGG GGGATGGTAGCCGCTTAAGCCTCTATAGCCCTTTAAGCATACCTGCC Electrophoresis electrophoresis agarose gel standard ethidium bromide Molecular cloning See steps on page 2 of this outline. What if you don’t have the gene? Polymerase Chain Reaction (PCR) Taq polymerase from Thermus aquaticus See PCR figure on separate handout (print in color)
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 2
Background image of page 3
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 04/22/2008 for the course BIO 325 taught by Professor Saxena during the Spring '08 term at University of Texas.

Page1 / 3

10DNATech - DNA Technology How do we manipulate DNA to do...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online