10DNATech - DNA Technology How do we manipulate DNA to do...

Info icon This preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
DNA Technology How do we manipulate DNA to do what we want it to do, both for analysis and for practical application? Restriction enzymes restriction endonuclease restriction site palindrome cut EcoRI GAATTC EcoRV GATATC Sau3AI GATC CTTAAG CTATAG CTAG -NNG AATTCNN- -NNGAT ATCNN- -NN GATCNN- -NNCTTAA GNN- -NNCTA TAGNN- -NNCTAG NN- restriction fragments sticky ends methylation CCCTACCATCGGCGAATTCGGAGATATCGGGAAATTCGTATGGACGG GGGATGGTAGCCGCTTAAGCCTCTATAGCCCTTTAAGCATACCTGCC Electrophoresis electrophoresis agarose gel standard ethidium bromide Molecular cloning See steps on page 2 of this outline. What if you don’t have the gene? Polymerase Chain Reaction (PCR) Taq polymerase from Thermus aquaticus See PCR figure on separate handout (print in color)
Image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern