BISC 150 (midterm 2)

BISC 150 (midterm 2) - 3 different mechanism of innate...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
3 different mechanism of innate immunity - Skin (external immunity). It secrets lactic and fatty acid to maintain a low PH which protect us from pathogen. Its membrane also blocks pathogen from getting in. - Mucus and ciliated epithelium . Mucus blocks pathogen as it enters the nose. The ciliated epithelium acts as filter to filter away pathogens. - Stomach (internal immunity). The stomach mucus blocks the pathogen from going in the blood stream. The acidic environment has a very low PH which destroys most of the pathogens. The following is a very small mRNA strand. How many amino acids does it code for? CGGAUGCCGAGUAUCUGAUGG - It codes for 4 amino acids. Every 3 RNA bases encode 1 amino acid. AUG stands for “Start”, it encodes Mel; and UGA &UGG stands for “Stop” and do not encode any amino acid. So start from AUG there are 4 amino acids encoded. What mutation causes sickle cell anemia? How does this mutation specifically affect the beta chain of hemoglobin and with what consequences? - Point mutation . It changes from GAG to GUG , and then Glu changes to Val in beta chain of Hemoglobin. Hemoglobin carries oxygen throughout the body when normal the globular molecules do not aggregate, enabling the cell to assume a rounded shape. In sickle cell disease, this point mutation results in a change in the surfaces of the molecules that causes aggregation into long, curved rods that deform the red blood cell. Patient cannot have much activity, and may suffer death from the lack of oxygen. How can sickle cell anemia be effectively traded? - It can be traded by
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 3

BISC 150 (midterm 2) - 3 different mechanism of innate...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online