07exam1 - Gene Action Exam 1 Winter 2007 Name:_ 1. (17 pts)...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Gene Action Exam 1 Winter 2007 Name:_____________________ 1. (17 pts) Imagine that the following DNA sequence comes from the middle of the wild- type lacI open reading frame, as indicated (the arrow shows the direction of transcription and translation of the gene). a. What amino acid sequence does this DNA sequence encode? (Diagram the codons and the corresponding amino acid sequence below.) b. On your sequence above, circle the codons which can be converted into codons for arginine by single base pair changes in the DNA, and write the base pair change necessary below each. 5’ ATGATATGGAGTTAACGCTCGCATACACTAGCA 3’ 3’ TACTATACCTCAATTGCGAGCGTATGTGATCGT 5’ UC A G U C A G U C A G U C A G U C A G U C A G UUU UUC UUA UUG CUU CUC CUA CUG AUU AUC AUA AUG GUU GUC GUA GUG UCU UCC UCA UCG UAU UAC UAA UAG UGU UGC UGA UGG CGU CGC CGA CGG AGU AGC AGA AGG GGG GGC GGA GGG GCU GCC GCA GCG GAU GAC GAA GAG CCU CCC CCA CCG ACU ACC ACA ACG CAU CAC CAA CAG AAU AAC AAA AAG Phe Leu Leu Val Ile Met Ala Thr Pro Ser Tyr Stop Stop His Gln Asn Lys Asp Glu Gly Arg Ser Arg Trp Stop Cys Second Position First Position (5' end) Third Position (3' end)
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
2. (15 pts) Imagine a bacterial cell with a linear double-stranded DNA molecule that is half-replicated. The cell is incubated just long enough to allow replication to be completed, generating two daughter DNA molecules, as shown here: Starting with the same half-replicated DNA molecule, imagine that the incubation takes place in the absence of DNA ligase, but all other replication enzymes function normally. The daughter DNA products might be predicted to be as shown here (on the right): For each of the following functions, predict how the daughter DNA products would look in the absence of the function listed (Draw the products you would expect).
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 04/26/2008 for the course MICROM 411 taught by Professor Gray during the Winter '08 term at University of Washington.

Page1 / 6

07exam1 - Gene Action Exam 1 Winter 2007 Name:_ 1. (17 pts)...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online