ch 18 b - gene expression in eukar yotes Comparing a...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 2/13/09! gene expression in eukar yotes! Comparing a different?! " A) " B) " C) D) " " E) liver cell nucleus to a lens cell nucleus, which of the follow ing would be Genes for albumin an d cr ystallin! general transcription factors! TATA boxes for albumin an d cr ystallin genes! Amino acid sequence of the RNA polymerase II use d to transcribe the albumin an d cr ystallin genes! activators nee de d for transcription of the albumin an d cr ystallin genes! Po ints were eukar yotic genes can be regulate d! Comparing a liver cell nucleus to a lens cell nucleus, which of the follow ing would be different?! " A) Genes for albumin an d cr ystallin! " B) general transcription factors! " C) TATA boxes for albumin an d cr ystallin genes! D) Amino acid sequence of the RNA polymerase II use d to transcribe the " albumin an d cr ystallin genes! " E) *activators nee de d for transcription of the albumin an d cr ystallin genes ! Upstream control elements! may be far upstream! close to the promoter! some control elements are foun d in introns also! 1! 2/13/09! Activator (or repressor) proteins recognize enhancer elements in the DNA, an d me diator proteins! cell-specific activation of specific genes! there are relatively few enhancer (DNA) elements, but the number of combinations is large! Fin ding the control elements for the GAS gene! GAS promoter region GAS reporter gene Functional analysis of control sequences:! by truncation -3000 -1800 -1250 -1000 -750 -100 Brian Ayre! -3080 - +12 -1764 - +12 -1078 - +12 35S (-60) -1816 - -123 -1334 - -123 -1816 - -634 -1816 - -1149 -1334 - -634 -678 - -123 Minimal sequence sufficient and necessary for minor vein expression -1334 - -1031 -1334 - -985 -1334 - -775 -1200 - -634 35 mutations were create d,! 3 sites are important Combinatorial control at define d sites 1324 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1314 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1304 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1294 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1284 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1274 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1264 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1254 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1244 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1234 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1224 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1214 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1204 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1194 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1184 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1174 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1164 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1154 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1144 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1134 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1124 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1114 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1104 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1094 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1084 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1074 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1064 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1054 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1044 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1034 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1024 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1014 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 1004 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 994 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC 984 TAGAACTAAAAAGTCGNCCGGTATGTGTCAAATAAACTTCTTTAAAATAA TATTAAAACTTCTCAAAATAATAGGAAAAAAAAGAAAAATTTCAAATTTA ATATATATATATATATATTGTAATATTAGCTTTCATTATCATTGAATTAA AAATTGCATATACAAGAATCGAATAATGTGGAGAAAGTAGTTTTCCTTTT TCAACTTTGTGTAGAGGCTAAGTCTCTAAAATATTGGCTTCGACTTTGTA CTTTTGGATCCGCCACCACAATCAGACAAACTTCCATTTGATCATTACCT TTATCGAATCAAATTCTTTCCCTTCCAATCTGTCACAATTTGAACATACC All veins - Major veins = Minor veins High Medium None Repressor in major veins Positive factors for all veins | -1304 | -1254 | -1204 | -1154 | -1114 | -1054 | | -1014 -985 Minor Vein Minor and Major Vein 35s -60 GUS Reporter n = 6 to 20 2! 2/13/09! Phylogenetic Fo otprinting in the Cucurbitaceae Conserved blocks after ~40 myr divergence Alternative RNA splicing to create different proteins w ith different functions! -590 +1 ATG -2792 Cucumis 3204 Citrullus 2893 Luffa 3257 Trichosanthes 2471 Cucurbita 1809 -2341 -1334 -985 Controlle d degradation of proteins by ubiquitin tagging! (turnover is the rule in biology)! microRNAs control gene expression by selective degradation of specific mRNAs! fragments about 20 nucleotides long! purifie d proteasomes ! This system might have evolve d from a virus defense system (or the other way aroun d!)! RNAi: a powerful new to ol in molecular biology (an d me dicine?)! synthesize a hairpin lo op of the gene you want to downregulate.! inject it (or intro duce it genetically) into a cell.! the mRNA w ill be degrade d.! V. phoeniceum transports raffinose an d stachyose in the phloem! is raffinose an d stachyose synthesis part of the phloem transport mechanism in this plant?! 3! 2/13/09! Downregulation of raffinose an d stachyose synthesis by RNAi! Ashlee McCaskill ! WT 8D 12B! Have a fine weeken d! 4! ...
View Full Document

{[ snackBarMessage ]}

Ask a homework question - tutors are online