AnswerKeyP3F08 - If you have any questions about an exam...

Info icon This preview shows pages 1–14. Sign up to view the full content.

View Full Document Right Arrow Icon
Image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 2
Image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 4
Image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 6
Image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 8
Image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 10
Image of page 11

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 12
Image of page 13

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 14
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: If you have any questions about an exam problem please see the TA that graded that problem. If you want your exam regraded you must submit it to Debbie Nero. I reserve the right to regrade the entire exam. Please include a note With the submitted exam telling me which problem you are questioning. Regrades for Prelim 2 may be submitted through noon, Friday, December 12. The mean for Prelim #3 is52. ‘ Question 1: Caroline, Dr Nero Question 2: Satyaki Question 3: 'Zhen, Jessica Question 4: Patrick, Question 5: Gabe, Mohan Question 6: Megan _ AoSQQE BIOGD 281 Third Preliminary Exam November 25, 2008 There are 13 pages to this exam, including this page. Be sure you have a complete set before you begin. Two blank pages forscratch paper have been attached at the end. The last page of the exam contains the genetic coding table and a table of the wobble rules. These last three pages may be removed. Put all answers in [the boxes or on the lines provided. Only answers in the boxes/lines will be graded. Examinations must be submitted by 12:05pm; late submissions will not be graded. Please turn off all cell phones and PDAs. Name Lab Section and TA Total IO 1. (20 pts) Shown below is the map of mutant sites in the trpA gene from E. 6011' compiled by C. Yanofsky and his students {rpm ~. h'pA _ w ;.; 1) cy5B . ' i ' - ' trpE trpD ' lrpC - " r ' .. ,. .. 2 , rx .3 r: firmwarw a ” w, -v‘ . a, ,/ ”—- ” ' ' - . A - ,,~’—'”’.’”’ A487 A46‘ * A53 A96 B57 A38 - ’3’”“”’.’ ’ ' A446' A223 A23 A137 Aml‘mwl " lefty/fl“ I ‘ \H 'i ' \n 9/ \ll‘/ : warm 1 '. ..,.~...l . . " ' . L - , a 23fle0_.4;+><———0.7_—j>le—~———‘1.6——f————>l\l<-‘l—3>le04—311ik——O.5—.—§l\| 0.3 10.2 - , ' ‘ " 0.04 0.001 0.06 door 0.02 . - " H" 1/ . ' . . \\ . \\ ll/ : n . z. \N- - ‘. , ‘ ., I—~C--—O--—H ‘ / .- . v - H ~///////\ . i -' . .9 - :175 17'} 183 2111' 21:1 213, 234_ 234 _2.35 268 ‘ Gm . Tyr~ Leu' Tm Gly Gly Gly I. my Gly ‘Sel'l'. - , J, ' l' 1,. l l i J, l l l a. ' Val .' Cys Avg. lle ‘Arg Glu Val Cys .Asp heu- A. ( 3 pts) You make the three F ' strains shown below. Each strain has a single tI‘p' mutant. ' F' B51 F' A487 F' A46 You cross each F ' to the F ' reC' strains shown below in the table. Indicate if the resultant exconjugate can (+) or cannot (-) grow on minimal medium. B. (6 pts) Using generalized transduction you make several crosses between trpA mutants selecting originally for cysB+ transductants. Indicate whether. many (M), few (F) or zero (Z) trp+ colonies are obtained in each cross Cross J Donor cysB+ A3 cysB' A96 grew; cysB+ A96 cysBr A3 m“)? cysB+ A487 cysB' A446 , I‘M . cysB+ A446 cysB' A487 , w cysB+ A78 ' cysB‘ A58 . ‘ A ”Zero cysB+ A58 ‘ ' cysB‘ A78 Few DJ C. (9 pts) Note at amino acid 234, Yanofsky found two independent mutations; A78 was Gly —> Cys and A58 was Gly —-> Asp. He then obtained revertants of each mutation back to wild type and determined the amino acid at position 234 in these revertants, as shown below. ./ Gly _ / G C \ Cys . Asp - 1164", ' ass/ac; ,Tyr Trp Ala Ala Glu Gly um; Lia-G GCA ' GCC Q’A g GGC On the line below each amino acid list the most probable RNA- codon(s). Remember that only singlebase changes or codon inversions are allowed. Use the attached genetic code dictionary to answer this question. D. (2 pts) Notice that in the genetic code there are six codons for Arginine. Assuming an organism uses all six codons, what is the minimum number of . Arg tRNAs that the organism must have and what are their anticodons? Use the attached wobble rule table to answer this question. ‘ Minimal number of tRNAs: '7" we Anticodons (S'to 3"): fill/L CU? - MCI/L GCG GR I ICG’ luc6~ 2. (14 pts) The following questions concern cloning vectors A. (6 pts) In the box below list the essential features of a plasmid cloning vector ‘— dram crf ref/26514100455” EwL _ «— {‘M Mtewéwzoa ‘54,?» NOW inkil ~ a Claim/Dr gszt’Js MW /‘ B. (8 pts) True or False 1. cDNA libraries have greater numbers of unique clones than genome libraries ‘ 2. cDNA clones are usually larger than genomic clones 3. cDNA clones lack introns and controlling sequences 4. Genomic clones lack introns but not controlling sequences 5. mRNA Can be used to probe genomic libraries 6.111 constructing cDNA libraries, reverse transcriptase is'used to clone retroviral genes ' 7. Reverse transcriptase is used to obtain RNA copies of DNA genes ' lib 1“ li bli In ti 8. Reverse transcriptase is used to generate probes > . 3.,‘(16 pts) You have cloned a Bani Hl fragment of DNA. Restriction enzyme digestion of this fragment with Bam H1, Eco RI and Sal I was done singly and doubly. The fragments were separated by gel electrophoresis and the gel was stained with ethidium bromide as shown in the figure below. The numbers refer to the sizes of the fragments in kilobases of DNA. BamHl/ , 3.4mm E0081 A. (6 pts') Draw a restriction map of the fragment indicating distances in kilobases between the sites. B. (2 pts) Briefly explain why this fragment probably came from a library designed for use in genomic sequencing. [It/[erm/ film /7’:!' 51% fflwrflkf 74 [fig/‘76 Came Fawn: («L PC'f/"éltl/ 549m HI 0/ (17295 4/ S’fmwic clef: Mc/ 7b nan/114’ cover/flax méergwm 7%: I’M/rm" f? / C. (8 pts) You have a genomic clone of a gene that has been sequenced along with 1 kb of sequence from each end. You now wish to insert this gene into an expression vector and need restriction sites 5' to the start site and 3' to the termination site of the gene. The mRNA sequences from the 5' and 3' ends of this gene are shown below. The start and stop codons are underlined. ' .5' end: 5' GGGGUAGGAGAUGGGGUCUCACACA. . .3' 3' end: 5' ...UUUUGCUCCUCTGCUAAGGGAAUACAU 3' You wish to clone this gene into a vector that has a Promoter then a Bam'Hl (S'GGATCC 3') cloning site followed by a Sal I (5' CAGCTG 3') cloning site. Design two primers that will allow you to use PCR to amplify the sequence of this gene from the start codon to the stop codon. The primers must also allow you to insert the amplicon into the expression vector. In order to obtain a PCR product these primers must have 10 bases Of overlap with the template sequence that is being amplified. 5 AAAtécjliAW/A'C , A: T 5 G6 ATC‘C GGG GMA (AG/AG 3 Primer 1: g 0AAttATrAA1LA AAA AAA Primer2: SJ CAGC Té/A 17’ TATTC-CC’ 3/ "i; .1 I S 4. (14 pts) Consider the following single strand of DNA: 3' GATCCAACTCTACTTATAGGCC 5' Assume you have a primer that anneals to the GATC Sequence at the 3' end of this single strand. You carry out a DNA sequencing reaction with fluorescently labeled dideoxynucleotides (ddA=Green, ddT=Red, ddC=blue, ddG=black). A. (8 pts) List the number of fragments and the sizes of fragments of each color: _ Number Sizes - Q, N, N, 15'i17 B. (6 pts) Is the template strand or the synthesized strand or neither likely to be the mRNA like strand of a gene? Explain your answer. , J ”TEMP/[€53 6%}sz cane/J be» — 9 6,610" Term/i5 93W, S'ynl’easmeci 5‘?me Cayb/ nor? be ~ [10 cape» [tacfi75 flmma 5. (20 pts) This question concerns the distribution of anonymous markers in the genomes of higher organisms and their use in finding genes with mutant phenotypes at the organisrnic level. A. (12 pts) A recent study used DNA chips to search for SNPs in 75 protein coding genes in 74 humans. They scanned 189 kb of genomic sequence containing 87 kb of exon sequence, 25 l<b of intron sequence, and 77 kb of transcribed but untranslated (i.e. S'UTR and 3'UTR) sequences. They discovered 874 SNPs of which 387 were in exons (called cSNPs). Of the cSNPs 209 would change an amino acid in one of the genes in the 189 kb of - genome sequence. Note in this experiment the PCR amplicons used to detect the SNPs were only from coding regions, i.e. UTRs, exons and introns. SNPs in intergenic regions would not be detected. 1. (3 pts) In their sample, what is the frequency of SNPs (i.e. number of baSe pairs per SNP)? » 2. (3 pts) Are the SNPs evenly diStributed among exons, introns and UTRs? Briefly explain why this is an expected or an unexpected result. Nb? , few/6i" 5M); m QXaM (9? 7/574) flaw in [In—[129,46 vb L177Q fa . (2/27/9742 . mica-(22¢! emcee; C SNPJa Ch’mfi?’ cam/n69 ciao/5 <1" a/fl’cz‘ frmém @5240” A . Carr) . lO 3. (3 pts) If there are 30,000 genes in our genome, how many SNPs are there within the average coding region (including UTRs, exons and introns)? 4. (3 pts) Other studies show that in exons, SNPs that change the amino acid per site where a base change will change the amino acid (dN) are generally fewer thanSNPs which do not change the amino acid averaged over such sites (d5). Briefly explain why this is the case for the majority of genes. 665/50th (CW/”5+ thél‘zl/aflf %% €42! dmwfl flc/clé "’ Ce/é‘c/fltrnynj gig/8639014 ll B. (8 pts) In Drosophila the recessive allele bw results in brown eyes, not the wild type color. A particular SNP (an AT vs GC base pair) is on the same chromosome as the bw gene. A homozygous broWn eyed fly which is also homozygous for the AT base pair at this SNP is crossed with a homozygous wild type fly which is also homozygous for the GC base pair. The F1 progeny have wild type eyes and both versions of the SNP, i.e. the AT and GC base pairs. When these F 1 progeny are test crossed with the true breeding brown eyed flies and the progeny scored for eye color and SNP patterns, the following results are obtained: —— . brown eyes, AT and GC SNPs , Total How many map units are there between the bw gene and the SNP? . v’ Map units [2- How many base pairs are there between the bw gene and the SNP? Base Pairs C {hi/lbnibase PalfS’Q it?“ [4494) N l2. ME \ 6. (16 pts) You are working with a newly discovered mutagen and you wish to determine the base change that it introduces into DNA. Thus far you have determined that the mutagen chemically alters a single base in such a way that . its base-pairing properties are altered permanently. In order to determine the specificity of the alteration you examine the amino acid changes that take place after mutagenesis. A sample of what you find is shown below: Original: Gln His Ile Glu Lys Mutant: Gln His Met Glu Lys Original: Ala Val Asn Arg Mutant: Ala Val Ser Arg Original: Arg Ser Leu. Mutant: Arg Ser Leu Trp Lys Thr Phe A. (3 pts) To what class of mutagens does this chemical belong?- ./ T B. (3 pts) What does this mutagen most likely cause: transitions, transversions ' or both? ' J C. (4 pts) What is (are) the base pair substitution(s) this mutagen causes? < 13 D. (6 pts) You now detect the following missense substitution in a protein after treatment with the mutagen: Wild type: , Ile Leu His Gln Mutant: Ile Pro His Gln Is the mutagen likely to be responsible for this substitution given your answers to parts A, B and C? Explain your answer. Yeg A461; W A vein/15$; Ccaolo/‘l. C, 7- . f . ‘ / 3/6746-5 __,. j/Gé&5/--v 5’Ccc 5...
View Full Document

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern