molecular_biology_practice

molecular_biology_practice - -Which strand is the...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
-Write the sequence for the complementary DNA strand above the one given -Write the sequence for the complementary RNA strand -Which strand is the template? -Which strand is the non template? -Write the amino acids that are coded for by this RNA 3’ GAGCTGTACTCGGTAACCGGGGAATGTTGCATTGTGAC 5’ DNA Which direction does RNA polymerase move on the DNA during transcription? In which direction is RNA and DNA synthesized? In which direction is the RNA translated/read to make a protein?
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Solution: -Write the sequence for the complementary DNA strand above the one given. -Write the sequence for the complementary RNA strand
Background image of page 2
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: -Which strand is the template?-Which strand is the non template?-Write the amino acids that are coded for by this RNA DNA 5 CTCGACATGAGCCATTGGCCCCTTACAACGTAACACTG 3 non-template 3 GAGCTGTACTCGGTAACCGGGGAATGTTGCATTGTGAC 5 template 5 CUCGACAUGAGCCAUUGGCCCCUUACAACGUAACACUG 3 RNA Met--Ser--His--Trp--Pro--Leu--Thr--Thr Stop Which direction does RNA polymerase move on the DNA during transcription? 3-5 In which direction is RNA and DNA synthesized? 5-3 In which direction is the RNA translated/read to make a protein? 5-3...
View Full Document

This note was uploaded on 03/31/2009 for the course BIOL 2051 taught by Professor Brininstool during the Spring '07 term at LSU.

Page1 / 2

molecular_biology_practice - -Which strand is the...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online