3_10_08_Biotechnolog - Clicker Question Clicker is the process in which RNA is synthesized and is the process in which protein is synthesized which

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Clicker Question Clicker _________ is the process in which RNA is _________ synthesized and _________ is the process in which protein is synthesized. which A) B) C) D) E) Translation, transcription Translation, transfection Transcription, translation Transliteration, translation Transnucleation, transformation Where are we? Where Last Time I Talked about… DNA, replication, transcription, translation and DNA, protein chemistry. protein Today and Wednesday… I will discuss biotechnology and talk about will how we can manipulate genes and produce proteins for our benefit. proteins I will also discuss the PCR technique that you will will use in lab. will The Genetic Frontier The While people long for While the security of civilization, we are also curious about what is yet to be known at its frontiers. frontiers. At the frontiers, which At are always changing, there can be hope and hope there can be horror. horror Knowledge unveiled Knowledge or revealed at the genetic frontier will change what it means to be human. means Where do we come from? What are we? Where are we going? Where Will Society be Prepared? Will http://nobelprize.org/nobel_prizes/medicine/laureates/1968/nirenberg-interview.html James Watson Speaks His Mind James "It's my impression that none of the genomeproject leaders have gotten up and said, 'What we are going to do with this information; I think we should use it’. Maybe they're afraid of offending people." "Going for perfection was something I always thought you should do. You always want the perfect girl." "Who wants an ugly baby?" Anna Kournikova Toronto Globe and Mail 26 October 2002. Evolution: Vertical Gene Transfer with Near-Perfect Fidelity with Horizontal Gene Transfer Horizontal When I talked about reproductive biology, When I talked about vertical gene transfer from vertical parent to offspring, and I assume that parent and vertical gene transfer with near perfect fidelity along with natural selection gave rise to the various extinct and extant taxa in the living world. in Today I will present historical evidence Today suggesting the possibility of horizontal gene transfer, and the methods used to gene and transfer genes with desired traits from any organism or taxon into another. any Cancers May Be Transmitted from Organism to Organism by Viruses Organism Peyton Rous (1911) Peyton described a cancer in chickens that could be transmitted from chicken to chicken. He found that “small He quantities of a cellquantities free filtrate have free sufficed to transmit the growth to susceptible fowl.” susceptible Genes Can Move Horizontally From One Taxon to Another Hermann Muller (1922) postulated that Hermann viruses may be genes. viruses Benjamin Duggar and Joanne Benjamin Armstrong (1923) suggested that viruses are “rebellious genes that have escaped from the chains of coordination.” coordination.” E. B. Wilson (1925) postulated that the E. genetic system responsible for the development and evolution of organisms could be affected by viruses. Indeed, viruses can cause “horizontal” Indeed, gene transfer between organisms and gene taxa making us all part of a genetic web of life. of The Gene for Virulence Can Be Transferred From a Dead Organism to a Live One in a Process Known as Transformation Process Fred Griffith (1928) demonstrated the process of gene transfer between organisms when he showed that transformation occurred between virulent and avirulent Pneumococci. Pneumococci. Engineered Horizontal Gene Transfer Transfer Stanley Cohen and Herbert Stanley Boyer developed and patented a technique to introduce horizontal gene transfer as part of the process of artificial selection. process Use a plasmid or a deactivated Use plasmid virus to facilitate the transfer. virus A plasmid is a small circular plasmid DNA molecule found in a bacterium that replicates faster than its large DNA molecule or “chromosome”. “chromosome”. Steps in Genetic Engineering Developed and Patented by Herbert Boyer and Stanley Cohen Cohen Choose and isolate the gene of interest from an Choose organism that has the desired trait. organism Insert the gene into (transform) bacteria that bacteria multiply and divide rapidly so that the gene gets cloned. cloned Isolate the protein of interest from the Isolate reproducing bacteria. reproducing Isolate the gene of interest from the Isolate reproducing bacteria and use it to transform eukaryotic organisms, iincluding cultured ncluding eukaryotic cells, plants, mice, sheep, cows and humans. cells, Select the Transformed Cells Select Select the transformed bacteria from the nontransformed bacteria by inserting a gene for antibiotic resistance along with the resistance gene of interest. (Antibiotic resistance can be induced in many ways →). Then grow the bacteria in the Then presence of the antibiotic antibiotic which will kill the nontransformed cells. nontransformed Isolate the growing colonies of Isolate bacteria which are composed only of transformed cells. only Cloning a Gene: Making Many Copies of a Gene Copies Isolate a plasmid. Isolate plasmid Insert the gene of Insert interest into a plasmid or deactivated virus, making recombinant DNA. DNA Recombinant DNA is Recombinant DNA that has been produced from the combination of two or more DNA sources. more Cloning a Gene: Making Many Copies of a Gene Copies Transform bacterial cells with the recombinant DNA. DNA. Bacterial cells multiply Bacterial and divide forming many and copies (clones) of the gene. gene. The bacteria then serve The as an abundant source abundant of the cloned gene or an gene abundant source of the protein encoded by the protein cloned gene. cloned Werner Arber, Daniel Nathans and Hamilton Smith Discovered that you Can Cut the Gene of Interest Out of the Genome with Restriction Enzymes Restriction Restriction Enzymes: A Bacterial Defense System Bacteria produce enzymes, known as restriction Bacteria enzymes that naturally protect the bacterial cells from enzymes attacks by viruses, known as bacteriophages or phages. phages The enzymes restrict the growth of the phages. restrict The restriction enzymes are named after the bacterium The restriction from which they were isolated (e.g. Eco R1 comes from E. coli—a bacterial species found in our colon). E. The restriction enzymes recognize a sequence of 4-8 The restriction nucleotides in the phage’s DNA and cuts it, inactivating the phage and restricting its ability to infect the bacterium. bacterium The bacterial DNA sequences that would be cut by the The restriction enzyme are methylated so that the enzyme does not recognize and cut the host sequence. does Restriction Enzymes Can Be Used as Molecular Scissors Scissors The restriction enzymes The recognize a sequence of 448 nucleotides in any DNA and can be used to cut it at this site. The restriction enzymes The cut the sequence so as to leave two “sticky ends”. leave Restriction enzymes are Restriction enzymes that act as molecular scissors once molecular they come in contact with the correct substrate and bind with high affinity. bind DNA Fragments of Different Sizes Can Be Separated by Electrophoresis Separated The restriction enzymes cut DNA from a given The organism into manageable pieces. organism The DNA is negatively charged and the various-sized The pieces can be separated by gel electrophoresis. gel Separation of DNA By Electrophoresis After Digestion with a Restriction Enzyme (SmaI) Enzyme Creating Recombinant DNA with a Restriction Enzyme and DNA Ligase Ligase A DNA fragment containing the gene of interest DNA along with nearby genes are isolated from their native DNA using a certain restriction enzyme. restriction The plasmid is cut with the same restriction The enzyme to make complementary “sticky enzyme ends”. ends”. When the DNA fragment containing the gene of When interest is mixed with the cut-open plasmid, the bases at the cut ends of the two complementary ends of the separate DNAs pair. pair DNA ligase is then used to covalently join the two DNA pieces. two DNA Ligase Joins the Gene to the Plasmid to Form Recombinant DNA DNA Transformation Transformation Bacteria are then Bacteria transformed with transformed the recombinant DNA plasmid. DNA The bacteria The multiply and divide to form a bacterial clone that carries many cloned copies of the inserted gene. gene. cDNA: Composed of Only Exons cDNA: A gene isolated from eukaryotes may gene have introns that the prokaryotic bacteria introns are not able to splice out in the appropriate way. appropriate In this case, one makes a gene with DNA In that is complementary to the fully spliced complementary messenger RNA. This is called cDNA. cDNA Making DNA from RNA requires an Making enzyme known as reverse transcriptase. reverse Reverse Transcriptase was Discovered in Retroviruses by David Baltimore and Howard Temin David Reverse Transcriptase Reverse Retroviruses Retroviruses utilize RNA as RNA their genetic material. (HIV is a retrovirus). retrovirus). Inside the host, Inside the viral RNA is RNA transcribed into viral DNA with DNA reverse transcriptase. transcriptase The viral DNA is The DNA inserted into the DNA of the host. Use cDNA Approach to Eliminate the Introns from the Gene the Isolate the messenger RNA of interest. Isolate messenger Add dATP, dGTP, dCTP and dTTP and the Add enzyme, reverse transcriptase, to make a single reverse to DNA strand that is complementary to the mRNA. DNA Eliminate the RNA using RNase. Eliminate RNase Add DNA polymerase and the deoxy nucleotides Add DNA to synthesize the complementary strand of DNA. This results in double stranded cDNA that codes cDNA only for the expressed sequences or exons. expressed exons The cDNA is then inserted into a plasmid and the The bacteria are transformed exactly as they are when genomic DNA, isolated from the genome, is genomic used. used. Transformation Vectors Transformation Bacteria are typically Bacteria transformed with plasmids or plasmids or bacteriophage. bacteriophage Plants are typically Plants transformed with the Ti plasmid from Agrobacterium. Agrobacterium Animals are typically Animals transformed with deactivated viruses. viruses Genes can also be shot into Genes the cells with the gene gun, gene developed by John Sanford at Cornell and on display at the Smithsonian Institute. Smithsonian John Sanford: Gene Gun John Applications of Genetic Engineering Applications Bacteria or other cultured cells Bacteria with the new gene can be cultured in a bioreactor so that bioreactor it will produce and secrete the protein coded by the gene of protein interest (e.g. insulin, EPO, human growth hormone, folliclehuman stimulating hormone, interferon, stimulating cellulases used to process biofuels or the digestive enzymes used in laundry detergent). used Many products are produced Many through the collaboration of biotech startups and pharmaceutical companies. pharmaceutical Herbert Boyer: Genentech (NYSE: DNA) DNA) http://www.gene.com/ Walter Gilbert: Biogen IDEC (NASDAQ: BIIB) http://www.biogenidec.com/ Arthur Kornberg: DNAX and Schering-Plough (NYSE: SGP) Schering-Plough http://summit.stanford.edu/newsevents/05_0415_kornberg.html Genetic Engineering & Biotechnology News: GENdex, Nasdaq Bio, Amex Bio GENdex, http://www.genengnews.com/ Insulin used to be isolated from cows and pigs—it sometimes caused an allergic response in humans. allergic Now recombinant “human Now insulin” is available and it does not cause an allergic response. response. lillydiabetes.com Human growth hormone used to be isolated from human cadavers to treat very short people with a human growth hormone (HGH) deficiency. human Now recombinant “human growth hormone” is Now available and there is no chance of contracting Creutzfeldt-Jakob disease from the cadaver. humatrope Recombinant Human Growth Hormone Recombinant www.nutropin.com Human follicleHuman folliclestimulating hormone (FSH), used for infertility treatments used to be isolated from the urine of postfrom menopausal women. menopausal Post-menopausal Post-menopausal women have low levels of estrogen and progesterone and high levels of FSH and LH. levels Now “urine-free” Now recombinant “human FSH” is available. FSH” follistim.com Recombinant Erythropoietin Made Erythropoietin in Mammalian Cell Cultures procrit.com Vaccines (Disease) Vaccines recombivax_hb Recombinant DNA Technology Makes Interferon Cheap and Accessible for the Treatment of Hepatitis and other Viral Infections Hepatitis pegintron.com Domestic Applications of Genetic Engineering: Laundry Detergents Engineering: Enzymes, made by Enzymes, genetic engineering make it possible to get clothes cleaner in cold water, thus saving energy and reducing the output of CO2. the http://www.novozymes.com/en/MainStructure/Sustainability/Themes/Environmental+assesment/Intro.htm Environmental Applications of Genetic Engineering Engineering Bacteria with added Bacteria genes can be used to clean up environmental clean toxins (e.g. can be toxins used to convert oil or an environmental estrogen to carbon dioxide and water). water). Various designer Various bacteria are matched to efficiently clean up spills of specific chemicals. http://www.novozymes.com/en/MainStructure/ProductsAndSolutions/Bioaugmentation++bioremediation/Surface+cleanup++remediation/BI-CHEM+ABR+Gasoline+Blend/ABR+Gasoline+Blend.htm Enzymes Used to Make Biofuels Enzymes Microbes can ferment sugars (you know the pathway) into ethanol. ethanol. A billion tons of sugar a year exists in the form of cellulose, a billion cellulose form of polymerized glucose. It comes from the straw polymerized It (inedible stems) of wheat, oats, barley and other grasses. (inedible Enzymes called cellulases, which are somewhat similar to cellulases which amylases, are necessary to convert the unavailable glucose in amylases are the form of cellulose into available glucose. Biotech companies are working on producing efficient enzymes Biotech that will convert cellulose to glucose. that Cellulosic Ethanol iogen.ca/cellulose_ethanol www.purevisiontechnology.com/ Applications of Genetic Engineering to Mass Production: Plant Cells also Become Pharmaceutical Factories Pharmaceutical Carbon dioxide, water and soil nutrients are used by plants to produce vaccines using the energy of sunlight. Vaccines are then isolated from the greenhouse-grown plants. Joyce Van Eck: GeneticallyJoyce engineered cultured tomato cells engineered produce a vaccine for poultry against the Deadly Newcastle Disease Virus Disease Genetically-engineered cultured tomato cells produce a vaccine (a harmless variant vaccine of a virus). of The genetically-engineered The cultured tomato cells contain the gene that produces a harmless viral protein which acts as an antigen against antigen which the poultry will make antibodies. antibodies Birds inoculated with the Birds vaccine will be resistant to the disease. disease. Why not Transform the Animals Themselves? Animals also Become Pharmaceutical Factories Sheep produce human Erythopoietin. Sheep Transgenic Pigs Ensure Uniform and Meaty Pigs and “Invention is the mother of necessity” No technology is either a panacea or an Armageddon, No but has advantages and disadvantages. but Although most people say, “Necessity is the mother of Although invention”, it is also true that “Invention is the mother of necessity”. The inventions change our idea of what is necessary (i.e. our priorities). is Go to the websites of the companies using Go recombinant DNA techniques, the relevant nonprofit organizations interested in biotechnology, PHRMA, a lobbying group for the pharmaceutical companies, and the relevant government regulatory agencies to see the risks and benefits of each product. the From Biotechnology to Chemistry: From Post-biotic Evolution? The human hormone The secretin is now being secretin synthesized by machines without the need for transcription or translation. or It is being used to It diagnose pancreatic exocrine function but could be used for people whose small intestines do not produce secretin. produce www.chirhoclin.com How do we find the DNA sequence in a human that codes for a particular trait? human If the amino acid sequence If of a protein is already known, it is easy to predict the DNA it sequence. sequence. Michael Smith found that he could synthesize Michael a short strand of DNA made of 9-17 nucleotides that code for the end of the gene he wanted and “fish out” the whole gene using DNA-DNA hybridization. DNA-DNA DNA Hybridization DNA Test Many Expressed Genes (cDNA) at a Time Using a a Gene Chip or Microarray Chip Test a Whole Human Genome (30,000 Genes) Using A Single Chip the Size of a Dime FISH (Fluorescence In Situ In Hybridization) Hybridization) A fluorescent dye fluorescent can be attached to the gene probe so that the gene can be localized in situ; that is, in its situ that natural location on the chromosomes using a light microscope. SKY: Spectral KarYotyping SKY: Identifying a Single Gene on Chromosome 11 Chromosome Identify Chromosomal Abnormalities (or Evolutionary Starting Points?) Starting Pre-Implantation Genetic Diagnosis (PGD) Pre-Implantation http://www.coloradospringsivf.com/birth/services.html Polymerase Chain Reaction (PCR) Polymerase Once a gene sequence is Once identified, we can use polymerase chain reaction polymerase (PCR) to produce many copies (i.e. clone) of the gene automatically. gene Kary Mullis invented PCR PCR to clone genes efficiently in vitro. vitro On the day he invented On PCR… PCR… “…Jennifer, that crazy, wonderful woman chemist, had Jennifer, dramatically left our house…. I was beginning to learn tragedy…. It would add strength to my character and depth someday to my writing. Just right then, I would have preferred a warm friend to cook with. Hold the tragedy lessons. December is a rotten month to be studying your love life from a distance. is I celebrated my victory with Fred Faloona….Fred had helped celebrated me that afternoon set up this first successful PCR reaction. this …I informed him that we had just changed the rules in …I molecular biology. ‘Okay, Doc, if you say so.’ He knew I was more concerned with my life than with those cute little purplemore topped tubes. In Berkeley it drizzles in the winter. Avocados ripen at odd In times and the tree in Fred's front yard was wet and sagging from a load of fruit. I was sagging as I walked out to my little silver Honda Civic…. Neither Fred, empty Becks bottles, nor the sweet smell of the dawn of the age of PCR could replace the Jenny. I was lonesome.” Jenny. Polymerase Chain Reaction (PCR) Polymerase Denaturation (94 °C) Denaturation Heat breaks the bonds between the complementary Heat base pairs of the double helix and the two antiparallel strands separate. Two different primers are added at a lower Two primers temperature so that they can anneal to the DNA. One primer is complementary to the beginning of a gene sequence on one strand and the other is complementary to the end of the sequence on the other strand. The four nucleotides containing A, T, C, G are added. The bases of the nucleotides pair with their complementary bases strands on the DNA. their The DNA polymerase links together the primers and The DNA the annealed nucleotides to make two new strands of DNA, one complementary to each parent strand. Annealing (65 °C) Annealing Extension (72°C) Roche Molecular Diagnostics Global Holds the Patent for PCR Global http://molecular.roche.com/roche_pcr/index.html DNA polymerase from E. coli E. Initially, the polymerase Initially, chain reactions were done using DNA polymerase from E. coli, polymerase E. the bacterium that lives in our large intestine (colon) at 37 °C. C. Every time the Every temperature of the DNA was raised to denature the DNA, the enzyme was destroyed and they had to add fresh enzyme during each extension step. each Thermus aquaticus: Thermophile Thermus Thermus aquaticus lives in hot (70 °C) C) springs in Yellowstone National Park. In order to live in hot springs, its polymerase must be stable at high temperatures, a quality temperatures quality needed for PCR. Cetus Corporation collected the bacterium from this source and isolated Taq polymerase from the polymerase bacterium. bacterium. Everyday Applications of PCR Everyday Diagnosis of Genetic Disorders Preimplantation genetic diagnosis Prenatal testing Tests for infectious diseases like HIV, Tests hepatitis, Human Papilloma Virus (HPV), etc. in people, animals, the blood supply and the food supply and Forensic Science Innocence Project Paternity Testing Diagnoses of Genetic Disorders Diagnoses After in vitro fertilization, After in DNA from a single embryonic cell is copied by PCR to diagnose genetic disorders, including cystic fibrosis, thalassemia, Tay-Sachs disease, Duchenne muscular dystrophy, spinal muscular atrophy, sickle cell anemia, early onset Alzheimer’s disease, hemophilia, and Huntington’s chorea. Huntington’s Preimplantation Genetic Diagnosis Preimplantation On day 3 of embryo development, one or two cells On are removed from each embryo and on day 4, the DNA from a cell of each embryo is subjected to PCR using the primers of interest. On day 5, the couple and staff of the clinic use On results of the genetic testing to determine which embryo should be transferred into the uterus. should PCR is Used for Testing for HIV, Hepatitis and other Infectious Diseases Diseases PCR is Used for Ensuring a Safe Blood Supply Blood PCR is Used for Testing the Safety of the Food Supply (e.g. Bird Flu) of PCR is Used in Forensic Science to Help Capture Criminals Help Use blood, tissue, semen Use from a crime scene from Extract DNA Perform PCR Compare genetic profile Compare of suspect and “controls” with the genetic profile found on evidence at the crime scene. crime Present evidence to a Present (scientifically literate) jury (scientifically Innocence Project: Barry Scheck and Peter Neufeld Use PCR to Set Innocent People Free Free PCR is Used for Paternity Testing: A Pop Quiz? Pop Based on this One Locus, this Man Cannot Be Excluded as the Possible Father Be The DNA markers from the mother and the putative father account for the DNA markers of the child at this locus. The father’s DNA at this locus accounts for all of the child’s DNA at this locus which could not have come from the mother. Alleles from Many Loci are Tested Alleles Alleles from loci 1,5, 7 and Alleles 10 do not exclude the do putative father. putative Alleles from loci 2, 3, 4, 6, Alleles 8 and 9 do exclude the putative father. If a putative father cannot If be excluded, the likeliness of paternity is likeliness calculated by taking into consideration the number of loci tested and the frequencies of the alleles at the various loci. at http://www.dnacenter.com/ idna-systems.com Paternity Testing Paternity In lab you are going to perform PCR on your own DNA and get your genetic profile for the D1S80 locus on Chromosome 1 locus D1S80: A Non-coding, Variable Number Tandem Repeat on Chromosome 1 Chromosome Primer Name: D1S80.PCR1.1 Primer Length: 28 Orientation: 5'-3‘ Orientation: Sequence: Sequence: GAAACTGGCCTCCAAACACTG GAAACTGGCCTCCAAACACTG CCCGCCG CCCGCCG Primer Name: D1S80.PCR1.2 Length: 29 Orientation: 5'-3' Sequence: GTCTTGTTGGAGATGCACGTG GTCTTGTTGGAGATGCACGTG The repeat unit in D1S80 is 16 base pairs. The DNA from the twins on the right are heterozygous for alleles with 18 and 24 repeats. repeats. PCR and Forensic Science PCR Each allele for D1S80 occurs with a certain Each frequency in the population. Allele 18 occurs in the general population with a frequency of 0.174 and allele 24 occurs in the general population with a frequency of 0.304. Since there are two ways to be a heterozygote, Since the probability of being an 18/24 heterozygote is: 2 * 0.174 * 0.304 * 100% = 10.6%. 0.174 To lower the probability with which a suspect To matches the DNA found at the crime scene, forensic scientists study alleles of about 13 genes. genes. Probability of Having a Unique Set of Alleles, Each Allele Having a Probability of 10% Probability 1 gene: 1/10 2 genes: 1/100 3 genes: 1/1000 4 genes: 1/10,000 5 genes: 1/100,000 6 genes: 1/1,000,000 7 genes: 1/10,000,000 8 genes: 1/100,000,000 9 genes: 1/1,000,000,000 10 genes: 1/10,000,000,000 Population = 6 billion You can be identified by approximately 10 of your genes! Rejection of PCR Manuscript “I knew that PCR would spread knew across the world like wildfire. This time there was no doubt in my mind: Nature would publish Nature it. it. They rejected it. So did They Science, the second most Science the prestigious journal in the world. Science offered that perhaps Science my paper could be published in some secondary journal, as they felt it would not be suitable to the needs of their readers, ‘F*** them,’ I said.” ‘F*** Kary Mullis and PCR Kary “It was some time before my disgust with the It journals mellowed. I accepted an offer by Ray Wu to publish it in Methods of Enzymology, a volume he Methods volume was preparing. He understood the power of PCR.” was “His book His challenges us to question the authority of scientific dogma even as it reveals the workings of an uncannily original scientific mind.” scientific http://www.karymullis.com/ http:// ...
View Full Document

This note was uploaded on 04/04/2009 for the course BIO G 110 taught by Professor Wayne,r. during the Spring '07 term at Cornell University (Engineering School).

Ask a homework question - tutors are online