Lect18 - Microbes Adapt: or The Central Dogma The basics of...

Info iconThis preview shows pages 1–13. Sign up to view the full content.

View Full Document Right Arrow Icon
Click to edit Master subtitle style Microbes Adapt:
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
The Central Dogma The basics of biology
Background image of page 2
Learning Goals Students will be able to explain the structural and functional differences between RNA and DNA. Students will understand the typical flow of information in biology: Students will know that RNA polymerase is responsible for transcription of DNA into RNA. Students will know that all genes encode RNA products Students will be able to explain basic similarities and differences in chromosome structure and DNA replication among bacteria, archaea, and eukaryotes. Students will understand the base-paired double helix structure of DNA and be able to explain how this affects cell replication.
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Central Dogma Recall the central dogma, process that governs all life. DN A mRN A Protein (functional unit) transcription translati on DN A replicatio n
Background image of page 4
Bases ; adenine, guanine, cytosine, uracil (RNA specific), thymine (DNA specific) Sugars ; ribose (RNA), deoxy ribose (DNA) Base + sugar = nucleo side Nucleic acid structure
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
adenine guanine thymine cytosine uracil nucleotid e C H3
Background image of page 6
Why not just one? Chemistry generates differences auto-catalytic cleavage facilitated by 2’-OH (RNA) DNA has a wider/shallower major groove and is less rigid, easier to store Why thymine? cytosine can easily degrade to uracil
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Function Dictates DNA (Information storage) Chemically stable, flexibility allows for easier storage - (histones) Double strand provides : Protection from chemical attack Redundancy of information (5’ and 3’ anti parallel)
Background image of page 8
Double Stranded Regions (Watson-Crick base pairs)
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Major Groove Minor Groove DNA Structure
Background image of page 10
Unstable RNA Temporary messages - mRNA Stable RNA Enzyme components (rRNA) Translator -tRNA RNA Can be double or single stranded, but not redundant in total
Background image of page 11

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Click to edit Master subtitle style CCGA UGCG - . C-G A-U U-A G-C C-G G-C C-G U-A C-G C-G -3' 5'- G-C G-C G-C C-G U-A G U G-C C-G G-C G U G U A-U U-A U-A U G C-G C-G A G-C G-C A U-A G U ACCA CGCCC GCGGG -- C G A C U A A C U U CUUA U G G A UUCGA G A A A C G C U G A U G A A G G A U G G A-U G U C-G C-G G-C C-G A G U A A A A A A A A A A G-C U C C-G U-A C-G A U-A U-A U-A C-G C-G A U G C-G C-G C-G U-A C-G U-A C-G A U G A C U-A C-G C-G A U C A C-G U G U-A A-U U-A C-G A-U G-C G-C C U U A AU A A C UAGUCGCAAACGACGAAAACUAC A A C C C A A A C U AUCGGACU
Background image of page 12
Image of page 13
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 04/07/2009 for the course MICROBIO 303 taught by Professor Kaspar/escalnte/downs during the Spring '09 term at Wisconsin.

Page1 / 42

Lect18 - Microbes Adapt: or The Central Dogma The basics of...

This preview shows document pages 1 - 13. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online