Lect20 - Her itable infor mation can be changed Mutations...

Info iconThis preview shows pages 1–10. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Her itable infor mation can be changed Mutations :- causes Lear ning Goals Students will understand that mutations occur randomly, mostly as replication errors. Students will understand how mutations in DNA lead to changes in phenotypes. Students will know that cells have mechanisms to repair mutations, and understand the basics of how those mechanisms operate. DNA polymerase proofreading Recombination Error-prone DNA polymerase Mismatch repair Students will be able to name several types of mutation-causing events: chemicals radiation replication errors. What is a mutation A change* in the DNA sequence Gene (genetic unit of function) Regulatory region Non-coding/extragenic sequence A-T C-G G-C A-T A-T G-C * from defined control What is a: Wild-type Strain to which all are compared (arbitrary, but critical!) Mutant An organism (or strain) with a mutation Genotype and Phenotype Genotype: DNA sequence of an organism. Phenotype: Behavior or appearance of an organism. Genotype and Phenotype Genotype: DNA sequence of an organism. Phenotype: Behavior or appearance of an organism. Wild-type mutant Types of mutations Frameshifts-unique insertion or deletion gain or loss of non(x3) base pairs Base substitutions (transitions or transversions) Silent Missense Nonsense Click to edit Master subtitle style Types of mutation Deletion abc dk lmn Duplication a bcdebcde fghi Insertion abcde xyz fghi Inversion abcde ihgf jkl Base substitution Replacing one base for another 1 . Transition : pur ine => pur ine OR pyr imidine => pyr imidine A to G OR G to A C to T OR T to C 2. Transversion : pur ine => pyr imidine ATGCCGTATGCTAGTCGGACGATCGTAGC TACGGCATACGATCAGCCTGCTAGCATCG ATGC G GTA A GCT G GTCG A ACGATC C TAGC TACG C CAT T CGA C CAGC T TGCTAG G ATCG Click to edit Master subtitle style...
View Full Document

This note was uploaded on 04/07/2009 for the course MICROBIO 303 taught by Professor Kaspar/escalnte/downs during the Spring '09 term at Wisconsin.

Page1 / 38

Lect20 - Her itable infor mation can be changed Mutations...

This preview shows document pages 1 - 10. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online