C11 - C1. It is a double-stranded structure that follows...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
C1. It is a double-stranded structure that follows the AT/GC rule. C2. Bidirectionality refers to the idea that two replication forks emanate from one origin of replication. There are four DNA strands being made in two directions radiating outward from the origin. C3. Statement C is not true. A new strand is always made from a preexisting template strand. Therefore, a double helix always contains one strand that is older than the other. C4. A. TTGGHTGUTGG HHUUTHUGHUU B. TTGGHTGUTGG HHUUTHUGHUU TTGGHTGUTGG CCAAACACCAA AACCCACAACC HHUUTHUGHUU TTGGHTGUTGG TTGGGTGTTGG CCAAACACCAA CCAAACACCAA AACCCACAACC AACCCACAACC GGTTTGTGGTT HHUUTHUGHUU C5. No. In a conservative mechanism, one double helix would always be fully methylated so the cell would not have any way to delay the next round of DNA replication via a methylation mechanism. C6. If we assume there are 4,600,000 bp of DNA, and that DNA replication is bidirectional at a rate of 750 nucleotides per second: If there were just a single replication fork: 4,600,000/750 = 6,133 seconds, or 102.2 minutes Because replication is bidirectional: 102.2/2 = 51.1 minutes Actually, this is an average value based on a variety of growth conditions. Under optimal growth conditions, replication can occur substantially faster. With regard to errors, if we assume an error rate of one mistake per 100,000,000 nucleotides: 4,600,000 × 1,000 bacteria = 4,600,000,000 nucleotides of replicated DNA 4,600,000,000/100,000,000 = 46 mistakes When you think about it, this is pretty amazing. In this population, DNA polymerase would cause only 46 single mistakes in a total of 1,000 bacteria, each containing 4.6 million bp of DNA. C7. 5 —————————DNA POLYMERASE——>3 3 ————————————————————————————————————5 Template strand C8. DNA polymerase would slide from right to left. The new strand would be 3 –CTAGGGCTAGGCGTATGTAAATGGTCTAGTGGTGG–5 C9. 1. DnaA boxes—binding sites for the DnaA protein 2. Methylation sites—sites of adenine methylation that are important for regulating DNA replication 3. AT-rich region—site where the DNA initially denatures to form a replication bubble C10. A. When looking at Figure 11.5, the first and third DnaA boxes are running in the same direction and the second and fourth DnaA boxes are running in the opposite direction. Once you realize that, you can see that the sequences are very similar to each other. B. According to the direction of the first DnaA box, the consensus sequence is TGTGGATAA ACACCTATT
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
C. This sequence is nine nucleotides long. Because there are four kinds of nucleotides (i.e., A, T, G, and C), the chance of this sequence occurring by random chance is 4 –9 , which equals once every 262,144 nucleotides. Because the
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 4

C11 - C1. It is a double-stranded structure that follows...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online