C18 - C3. Here is an example: GGGCCCATATATATGGGCCC...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
C1. First, cloned genes can be used for DNA sequencing. This has allowed researchers to understand genetics at the molecular level. Second, cloned DNA can be mutated using site-directed mutagenesis to see how specific mutations alter the structure and function of DNA. Third, cloning is useful in biotechnology. This topic is discussed more thoroughly in Chapter 20. And many others. C2. A restriction enzyme recognizes a DNA sequence and then cleaves a (covalent) phosphoester bond in each of two DNA strands.
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: C3. Here is an example: GGGCCCATATATATGGGCCC CCCGGGTATATATACCCGGG C4. The term cDNA refers to DNA that is derived from mRNA. Compared to genomic DNA, it would lack introns. C5. A dideoxynucleotide is missing the 3 OH group. When the 5 end of a dideoxynucleotide is added to a growing strand of DNA, another phosphoester bond cannot be formed at the 3 position. Therefore, the dideoxynucleotide terminates any further addition of nucleotides to the growing strand of DNA....
View Full Document

Ask a homework question - tutors are online