E12 - E1. The location of the intron within the cDNA is...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
E1. The location of the intron within the cDNA is shown below: cDNA: 5 -ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGC GGCCAGACTATCACCCAACTCG. .. INTRON. ..GTTACCTACTAGTATATCCCATATACTAGCATATATTTT ACCCATAATTTGTGTGTGGGTATACAGTATAATCATATA–3 You can figure this out by finding where the sequence of the genomic DNA begins to differ from the sequence of the cDNA. The genomic DNA has the normal splice sites that are described in Figure 12.21. Genomic DNA: 5 ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACTATCACCCAACTCGG CC CACCCCCCAGGTTTACACAGTCATACCATACATACAAAAATCGCAGTTACTT A TCC CAAAAAAACCTAG ATACCCCACATACTATTAACTCTTTCTTTCTAG TTACCTACTAGTATATCCCATATACTAGCATATATTTT ACCCATAATTTGTGTGTGGGTATACAGTATAATCATATA–3 The splice donor and acceptor sites are underlined. The space indicates where the strands in the corresponding RNA would be cut. The branch site is also underlined. The large A is the adenine that participates in the transesterification reaction. E2. An R loop is a loop of DNA that occurs when RNA is hybridized to double-stranded DNA. While the RNA is hydrogen bonding to one of the DNA strands, the other strand does not have a partner to hydrogen bond with so it bubbles out as a loop. RNA is complementary to the template strand, so that is the strand it binds to.
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
E3. E4. The 1,100-nucleotide band would be observed from a normal individual (lane 1). A deletion that removed the –50 to –100 region would greatly diminish transcription, so the homozygote would produce hardly any of the
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 3

E12 - E1. The location of the intron within the cDNA is...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online