Bioinformatics nisha - Bioinformatics Bioinformatics The...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Bioinformatics Bioinformatics The creation and advancement of algorithms, computational and statistical techniques, and theory to solve formal and practical problems arising from the management and analysis of biological data. Bioinformatics Data processing for biologists A comparison of genes within a species or between different species can show similarities between protein functions, or relations between species (the use of molecular systematics to construct phylogenetic trees). With the growing amount of data, it long ago became impractical to analyze DNA sequences manually. Today, computer programs are used to search the genome of thousands of organisms, containing billions of nucleotides. These programs would compensate for mutations (exchanged, deleted or inserted bases) in the DNA sequence, in order to identify sequences that are related Another aspect of bioinformatics in sequence analysis is the automatic search for genes and regulatory sequences within a genome Bioinformatics attempts to model and interprets this pathway: genome introns/exons gene sequence protein sequence protein structure protein function cellular pathways networks Genomics: comparative genomics, genome annotation, microarray technology, DNA sequencing Proteomics: protein structure, 3D structural prediction, cellular pathways & networks (regulatory and metabolic) sequence TGCTTCTGACTATAATAGACAGGGTAAAGACCTGATTTTTGA GTAACATGCAGTAAGATACAAATCGCTAGGTAACACTATCAG GTAAACACGGTACGATGTACCACATGAAACGACAGTGAGTCA ACCTCTGGCGGTGATAATGGTTGCATGTACTAAGGAGGTTG GCTTCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAA TA AT A T common bases that occur in at least 4 of the 5 sequences fd T7 A2 promoter T7 A3 promoter PR promoter lacUV5 promoter promoter T82A89T52A59A49T8 9 The Pribnow Box T78T82G68A58C52A54 17bp T82A89T52A59A49T89 The Pribnow Box -35 Region B L A S T B asic L ocal A lignment S earch T ool 5' 3' 5' 3' 5' 3' 5' 3' ATGGTTGCTTGTTCTCTTGCTCT TCGTATGGAAATTCTTGCTTTTG GTCTTGGTTATGATCCTCGTACT CATACTGATATTGAAATTACTCT TTGTGCTGATCTTGAAATGCCTG CTGTTGAAGGTGGTTCTATTGAA GTTATTCTTAAAATTACTACTTAT GAAGTTATTCTTAAAATTACTACT TATGAAGTTATTCTTAAAATTACT ACTTATTCTGCTTCTGTTCTTATT GCTGAAGTTGCTAAAGGTGGTC GTGCTTCTCCTCTTGAACGTCTT ATTCTTGAAGAAGAAATTCTTGC TTTTGGTCTTGAAATTACTCTTTC TGCTACTGCTAATGAAGCTACTT CTATGATTTGTGAAGGTACTGAT GATATGCCTATTACTTGTGCTCT TCTTATGGAATCTACTATTAATAA ATAT ORF finder ...
View Full Document

This note was uploaded on 05/03/2008 for the course BIO 2322 taught by Professor Spotswood during the Spring '08 term at The University of Texas at San Antonio- San Antonio.

Ask a homework question - tutors are online