data for problem5-Assignment 2

An Introduction to Bioinformatics Algorithms (Computational Molecular Biology)

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon Sequence 1: ttgtttgtttttgtttttgtttgagatggagtttcgctcttattgcccaggctggagtgc agtggcgtgatttcggctcactgcaacctccccttcctgcattcaagcgattctcctgcc Sequence 2: atggtgcattttactgctgaggagaaggctgccgtcactagcctgtggagcaagatgaat
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: gtggaagaggctggaggtgaagccttgggcaggctcctcgttgtttacccctggacccag [2/14/2008 11:29:45 AM]...
View Full Document

This homework help was uploaded on 02/14/2008 for the course CSE 182 taught by Professor Bafna during the Fall '06 term at UCSD.

Ask a homework question - tutors are online