3.1 Key - 5.-3 The above nucleotide sequence represents a...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
5’-…ATGGGGCTGTATACGTAACATTAG…-3’ The above nucleotide sequence represents a single stranded fragment of bacterial DNA. Use the information contained in this polymer to answer the following questions. 1. What is the sequence of DNA that would complement all of the nucleotides above? Include in your answer the labels for the 5’ and 3’ ends. 3’…TACCCCGACATATGCATTGTAATC…5’ 2. How should the sequence of the transcript read? Again use the information from the sequence above. Label the 5’ and 3’ ends. 5’-…AUGGGGCUGUAUACGUAACAUUAG…-3’ 3. What amino acid sequence would be translated? Use table 11.4 to convert codons to protein monomers. …Met-Gly-Leu-Tyr-Thr-STOP
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
4. Which of the following statements regarding replication and transcription is true ? A. Replication is semi-conservative and transcription produces a single-stranded nucleic acid polymer. B. In replication, nucleotides are polymerized in the 5’ to 3’ direction; in transcription, nucleotides are added in a 3’ to 5’ direction. C. Replication requires an RNA primer, while transcription requires a DNA primer. D. Transcription utilizes bi-directional transcription forks while replication in bacteria occurs in a single direction. E. Synthesis of nucleic acids during replication is continuous, while nucleic acid synthesis in transcription is non- continuous. 5. Which of the following statements is false ? A. Thymine is not normally found in RNA while uracil is not normally found in DNA. B. The bases of tRNA can be modified to generate non-conventional bases such as pseudouridine. C. DNA polymerase adds nucleotides in one direction. D. RNA polymerase adds nucleotides in one direction. E. Replication ends at the termination (ter) site, while transcription ends at stop codons UGA, UAA, or UAG. Wild-type 5’-…ATGGGGCTGTATACGTAACATTAG…-3’ Mutant 5’-…ATGGG A CTGTATACGTAACATTAG…-3’ A spontaneous mutation has occurred in the wild-type sequence resulting in progeny having a mutant allele. The altered base change has been underlined. 6.
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

Page1 / 6

3.1 Key - 5.-3 The above nucleotide sequence represents a...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online