{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

Last_Years_2006_Midterm_1

Last_Years_2006_Midterm_1 - MCDB 1A MIDTERM EXAMINATION...

Info iconThis preview shows pages 1–10. Sign up to view the full content.

View Full Document Right Arrow Icon
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Background image of page 2
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Background image of page 4
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Background image of page 6
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Background image of page 8
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Background image of page 10
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: MCDB 1A MIDTERM EXAMINATION October 25, 2006 Scantron Instructions: 1. Use a #2 pencil to complete the form. 2. Write your name and fill in the appropriate bubbles. 3. Write your perm. number in the ID number box and fill in the bubbles. 4. Write the color of your test in the space underneath the ID number box. 5. Fill in the entire rectanle of the BEST answer. If ou erase, erase completel . READ ALL QUESTIONS THOROUGHLY IN ALL CASES, PICK THE BEST ANSWER 33 QUESTIONS - 3 POINTS EACH 1 POINT FOR WRITING THE COLOR OF YOUR TEST ON THE SCANTRON AND FILLING IN THE BUBBLES CORRECTLY (if you fail to do this correctly, you really will not earn that point!!!) STAY CALM, CONCENTRATE AND GOOD LUCK GENETIC CODE, AND METABOLIC PATHWAYS DIAGRAMS AT END OF TEST 1. Consider the following mRNA: 5‘ GGGACGAUGUUUCAAAGGGUGUUUCAACCCUAAGUGUCAUGA How many amino acids would be in the encoded protein? .6 .7 .8 .9 CDQOD'Q) . some other number N What amino acid would be at position 5? phenylalanine . serine alanine . valine . some other amino acid CDQF‘JCJ'QJ 3. Consider the experiments using synthetic RNA molecules that were used to figure out the genetic code. How many different peptides would be synthesized if you used the RNA sequence: 5’ AGCAGCAGCAGCAGCAGCAGC 3’ in the test tube reaction? ‘I 2 3 0 need more information to answer the question FDR-.057?” Which of the following processes does not require an input of energy to proceed? Synthesis of phospholipids Translation Replication Transcription All of the above reactions require energy in order to proceed FDR-.0259”? Place the following structures in order of their size, from largest to smallest: protein, nucleus, triglyceride, ribosome nucleus, ribosome, triglyceride, protein nucleus, protein, ribosome, triglyceride nucleus, ribosome, protein, triglerceride, none of the above is correct 599-9???“ F” Consider the amino acid serine (structure on the right). Is the “R” group: a non-polar i polar but uncharged "’C- " C01,.“ polar and charged ‘ green C“ 2- none of the above is a correct answer 3“ 509.0235» T‘J Imagine you were a soluble cytoplasmic protein and for some reason, an enzyme came along and attached a long chain fatty acid onto you (this actually happens in cells and can be very important!). Which of the following is a reasonable thing to hypothesize might happen? I would tuck the fatty acid chain into my hydrophobic interior I would re—locate myself to the plasma membrane, inserting the fatty acid into the membrane 0. Nothing would change — I would continue to float around the cytoplasm with the fatty acid extending outward. Two of the above are reasonable possibilities FT!” P- Glycogen is a great source of stored energy because it is composed of polymerized lactose it is composed of polymerized cellulose it is composed of polymerized glucose it is composed of polymerized baseballs none of the above is correct FDPPR'P’P" $0 Consider the Otsz hemoglobin structure. What kind(s) of chemical interactions hold the quaternary structure together? weak forces only covalent bonds only weak forces and covalent bonds more information is required to answer the question 9.0.6.!» 10. Consider a membrane protein that spans the entire width of the plasma membrane, having approximately 200 amino acids on either side of the membrane and 20 amino acids actually going through the membrane. Where in the protein would you most likely observe disulfide bonding? in the region of the protein extending into the outside of the cell in the region of the protein within the lipid bilayer in the region of the protein extending into the inside of the cell disulfide bonds could easily be in more than one of these locations 9.0.39: 11. Given the logic we discussed in class used to rationalize why our genetic code uses three nucleotides for a codon, how many nucleotides would you hypothesize are in a codon if we had only 17 amino acids rather than 20? 2 3 4 need more information to answer the questions 9.0 .093 12. . Which is a true statement? a. Okazaki fragments are found in the leading strand of DNA replication and are necessary because DNA polymerase can only synthesize DNA in the 5' to 3' direction. b. Okazaki fragments are found in the lagging strand of DNA replication and are necessary because DNA polymerase can only synthesize DNA in the 5' to 3‘ direction. 0. Okazaki fragments are found in the leading strand of DNA replication and are necessary because DNA polymerase can only synthesize DNA in the 3' to 5‘ direction. d. Okazaki fragments are found in the lagging strand of DNA replication and are necessary because DNA polymerase can only synthesize DNA in the 3' to 5 direction. 13. Both Fredrick Griffith and Oswald Avery performed fantastic “transformation” experiments using “R” and "S" bacteria. The Griffith experiment was performed in 1928 while the Avery expt was performed in 1944. What was the major technical advance of the Avery expt over the earlier Griffith experiment? a. Avery used a newly developed strain of R and 8 cells that were much more efficient at transformation b. Avery was able to fractionate the cell’s components; in other words, he could separate the DNA from the protein, from the lipids, etc o. Avery used a different strain of mice that allowed for more precise quantitation of the resulting data ' d. None of the above statements are true e. More than one of the above statements are true 14. Consider the Hershey-Chase experiment in 1953 which used the bacteriophage T2. Which of the following question(s) were addressed by this experiment? a. Is RNA the intermediate between DNA and protein? b. Is protein the genetic material? o. Is DNA the genetic material? d. Does radioactivity affect the nature of heredity? e. Two of the above are correct 15. If human cells have 29% A in their RNA, how much C is present? a. 29% b. 25% o. 21% d. no way to know based on the given information 16. The major question being asked in the Meselson-Stahl experiment that made use of N14 and N15 was: a. Is DNA the genetic material b. Is protein the genetic material c. Do the two strands of DNA separate during replication? d. None of the above is a correct answer 17. Why are RNA primers needed during replication? a. DNA polymerase can not start new chains but primase can start new chains b. DNA ligase can not seal DNA to DNA, but can seal DNA to RNA 0. DNA polymerase requires primase in order to get in the right position at the replication fork d. None of the above is a correct answer 18. Which of the following is likely to be the most dangerous kind of error for an organism? a. an error in protein localization b. an error in translation 0. an error in transcription d. an error in replication e. more information is necessary in order to answer the question 19. imagine that the reaction A + B 9 C + D has a delta G = +4 kcal/moie. What does this mean about the reaction? a. it will proceed to 0+ D, but will take a very long time to complete b. it will not proceed to C + D no matter how long you wait 0. it will proceed to C + D, and it will do it quickly all by itself d. it will proceed to C + D, but only with the help of an enzyme 20. Is this the proper chemistry for peptide bond formation? [-1 ‘1 ’ o H iLL o f ‘P“C"'C-' Ji- "Homes-139 +ATQ H / ll \0 u H / i \OW Kt H H I I' l // \M-C. -c.-p-c_-—C, . H, I i \ +P~3>€+9t+HLO R‘ H O H a. yes b. no , _ I Q ‘ 21. Which strand of DNA in the replication fork drawn to the right 3 is going to be the template for the "tagging strand? a. strand #1 b. strand #2 5w“ 0. both will be lagging strands a SM d. neither strand will be a lagging strand ‘ 3 tr =9? 7- e. more information is required to answer the question i 6‘ 3 22. Consider the following transcription bubble. If the sequence to be transcribed is to the right of the bubble. will the upper or lower strand of DNA serve as the template for RNA polymerase? 6t #7“ 3' 3' a. upper QO\V\VW to. lower 0. insufficient information to answer the question 23. If a mutation occurs in DNA such that the corresponding codon is changed from AGU to AGC, what kind of mutation is this? a. silent mutation b. missense mutation c. nonsense mutation d. frameshift mutation 24. Consider a gene that encodes a protein that is 533 amino acids longs. The protein is named “WhatAGreatYearForBaseball". Unfortunately. the region of DNA encoding codon 234 (5' UCA 3') suffers a mutation that causes its sequence to change. Which of the following changes in the resulting codon would be most liker to cause the most serious consequences? a. UCA to UCC b. UCA to ACA c. UCA to UAA d. UCA to UCU e. UCA to UUA 25. In the Hershey—Chase experiment, P32 was used to label DNA. What part of the DNA would become radioactive? a. the pyrimidines b. the purines c. the backbone d. more than one of the above is correct e. none of the above is correct 26. Alternative splicing is a process that occurs in the maturation of: a. DNA molecules b. RNA molecules c. protein molecules d. polysaccharide molecules e. lipid molecules 27. The molecule drawn to the side is a precursor for which class of macromolecule? CHILD“ a. lipid . H b. polysaccharide H D c. protein - . a d. nucleic acid on U Ill 28. Recall the Meselson-Stahl experiment using N14..and N15 to examine the mechanism of DNA replication. Imagine that the cells were grown originally in N15 and then shifted at "time zero" to N14 media. If DNA replication proceeds by a "semi-conservative" mechanism as discussed in class, what would be the proportion of H:H to H:L to L:L after4 rounds of replication? a. 012114 b. 20:6 o. 0:26 d. 0:4:4 e. some other ratio 29. If a triglyceride were to associate with a lipid bilayer, where would you expect it to most comfortably reside? inside the bilayer on the outer surface of the bilayer both “a” and “b” are resonable answers none of the above are reasonable answers P-F’P'F” 0. Which of the following molecules are not involved in the polymerase chain reaction (PCR)? DNA ligase DNA polymerase Oligonucieotides Nucleotides All of the above are required for the polymerase chain reaction 00 sneer-rs» 31. If you started with 10 identical, double stranded DNA molecules and subjected them to 5 rounds of PCR, how many copies of the DNA molecule would you have at the end of round 5? 15 50 160 320 some other number sensor" 32. Consider a codon with the sequence 5’ ACU 3’. What would the sequence be of the anticodon that hydrogen bonds with this codon? b. 5' UGA 3’ c. 5‘ TGA 3’ d. 5’AGT 3' e 5’ AGU 3' 1‘. Some other sequence 33. Imagine that you are a very hungry cell and suddenly get a big supply of isocitrate. For each isocitrate that you metabolize all the way through electron transporti’oxidative phosphorylation, how many net ATPs will you generate? 5 . 8 . 12 16 some other number thence 34. The color of your exam is a. white b. yellow First letter alanine A _ G Leucme A G Methionine; start codon ACA ACG Second letter Threonine Tyrosine UAA UAG CAU CAC CAA CAG AAU AAC AAG GAU GAC GAA GAG Stop codon Stop cndon Histidine Glutaminc Asparagine Lysine Aspartic acid Glutamic acid UGU Cysteine Stop codon Tryptophan Arginine Serine Arginine Glycine mmmm 131131 WE‘LL ctrconsrs ENERGYJNV‘ES’I‘ING 7.6 Glycolysis Converts Glucose to . REAGIONS CH2C) . Pyruvate Ten enzymes. startmg with | hexokinase. catalyze ten reactions in turn. CH OH H— C— OH Along the way. ATP is produced {reac— 2 Glyceralclehyde I _ tions 7 and 10],and IWO NAD+ are H H O H 3-phosphate (GBP) C — reduced to two NADH + H’“ (reaction 6). (2 molecules) I OH H H HO 0“ 6 The two molecules ofGaP Triose phosphate 4— 2 @P' am has hate mu 5 and "- H OH 11.1 .. 2NAD+ g pup 9. p LI Ilm L l' l,“ WWW-“t are oxrd1:ed.formrng two ('iILIIUI. Glucose 2 NADH +6 molecules of NADH + HJr ' and two molecules of 1.3— Hmnkm W CIHEO . bisphosphoglycerate (BPG). RISIE'Illll{-;\[l\t)li\' @ H# C_ i I 1,3-BIsphosphoglycerate (BPG) C : O (2 molecules) 1 ATP transfers a phosphate to CH3O . I the 6-carbon sugar glucose. H H O H 0 . T The two molecules of BPG HO OH H OH 1‘ImSPIIUeg-mmm 2 @ transfer phosphate groups kimw 2 to ADP. forming two ATPs H OH and two molecules of 3- phosphoglycerate (3P6). Glucose 6-phosphate [061’] EH30 O Phusplmhvxosu H — C'— OH 3-Phosphoglycerate (3pc) isnmvrasu I (2 molecules) C : O | CH,0 . 0‘ ' CHjOH Glucose ophosphate is O ' rearranged to form its isomer. ,l _ y ._ I ., 8 The phosphate groups on fructose-e—phosphate. H HO 1 mhphubl" u mm U km the two 3965 move, H OH . forming two 2—phospho— | cerates {2P6}. OH H CHZOH 9 y chtose-6-phospl1ate (F6P} I HC— 0—— O I 2-Phosphoglycerale (ZPG) l‘h05plmfructnkinnsc (I: : 0 (2 moleallcs) @ O- A second ATP transfers a CHzo . CH O . En‘fi‘w“ 2 FOI 2 2 phosphate to create fructose- O 9 The two mOIeCUIeS, 0f 2P6 mbisphosphata lose water, becoming two H HO high—energy phospho- H 0“ fiHz enolpyruvates (PEP). OH H C _ O_ . Fmdflse-LG-bisphosphate [FBP] Ia Phosphoenolpyruvale (PEP) (1‘ — O [2 molecules) 4 Tlhe fructgse rilng opens,6 and Md Ohm, O” t e fi-car on ructose 1 - . . v . ' 10 Frnally. the two PEPs b'sphosphate breaks mm the Hwy-m. 2 @ transfer their phosphates to 3-carbon sugar phosphate - I ‘ . BAP d. . 63p kmast: 2 {ENE} ADP. forming two ATPs 6" "5 'somer ' and two molecules of CHZO O I pyruvater Isumt-rase H— Cg. OH CH3 C ‘— O T— I — I 5 The DAP molecule I — (I: _' O f I O From every glucose molecule, is reananged to CH‘OH __ glycolysis nets two molecules form another GBP _ ‘ H C _ O of ATP and two molecules of molecule Dnhydroxyacetone Glyceraldehyde I _ the electron carrier NADH‘ phosphate (BAP) 3-phosphate (G3I’) 0 Tm, molecules of pymvate [2 molecules) Pymvate are produced. (2 molecules} 7.8 Pyruvate Oxidation and the Citric Acid Cycle Pyruvate diffuses into the mitochondrion and is oxi- dized to acetyl CoA. which enters the citric acid cycle. Reactions 3,4,6, and 8 accomplish the major overall 0' effects ofthe cycle—the trapping of energy—by passing elec— trons to NAD or FAD. Reaction Straps energy directly in ATP Pyruvate oxidation and the citric acid cycle take place in the mitochondrial matrix. Mitochondrion {ii Vr('()l.‘l'.‘ilh Pyruvate Coenzymo A ' + :9 PYRUVATE ' OXIDATION cmuc O2 Pyruvate is oxidized to acetate, ACID 0 with the formation of NADH + H+ CYCLE and the release of C02; acetate is activated by combination with C _ COA coenzyme A. yielding acetyl CoA. RFM‘I I! ATO RY CHAIR. Acelyl CoA 8 Malate is oxidized to oxaioacetate. with the formation of NADH + H“. Oxaloacetate can now react with acetyl CoA to reenter the cycle. 1 The two-carbon acetyl group and four-carbon oxaloacetate combine, forming six-carbon citrate. NM" 00' €ng _ Oxaloacetate COO- C 00 C00 | | Citrate (citric acid) C H2 H0 — CH I I HC '—COO' CH, I 2 C v d | ‘ PIG—CH Itrate Is rearrange COO" to form Its Isomer, Malate COO- isocitrate. F Fumarate and 150mm“- water react, CITRIC ACID - + forming malate. / ' CYCLE I NAD . . CIOO +o i H HC | COO" _ 3 Isocitrate is oxidized Fumarate COO to ot-ketoglutarate, | yielding NADH + H+ @ C|H2 and co}. €le CoA (“3 6 Succinate is oxidized \ FAD _ _ to furnarate. with the C00 (I: COA formation of FADHZ. Succinate CH | C H2 i??? c'oo- Succinyl CoA S Succinyl CoA releases coenzyme A. becoming succinate; the energy thus released converts GDP to GTP. which in turn converts ADP to ATP. 4 ot-Ketoglutarate is oxidized to succinyl CoA. with the formation of NADH + H+ and C02; this step is almost identical to pyruvate oxidation. ...
View Full Document

{[ snackBarMessage ]}

Page1 / 10

Last_Years_2006_Midterm_1 - MCDB 1A MIDTERM EXAMINATION...

This preview shows document pages 1 - 10. Sign up to view the full document.

View Full Document Right Arrow Icon bookmark
Ask a homework question - tutors are online