
Activity%2023%20%20DNA%20PCR%20and%20Forensics-Key - Name...

Info icon This preview shows pages 1–2. Sign up to view the full content.

Name: BIOL1107 Activity #23 DNA, PCR, and Forensics 1) Polymerase Chain Reaction (PCR) mimics DNA replication in many ways. Five enzymes important for replication are listed below. Indicate if the function performed by each enzyme is needed for PCR and, if so, how that function is carried out. Replication PCR Helicase SSB Primase DNA Polymerase Ligase 2) Use the DNA molecule shown above, to answer the following questions: a) You use the DNA primer 5’ATAGTT 3’ to initiate replication of the DNA molecule above. i) Explain which strand (top or bottom) will be used as the template for new DNA synthesis and why. ii) Write out the sequence of the newly synthesized DNA strand starting from the 5’ end of the molecule. b) Write out the sequence of two 6 nucleotide long DNA primers that would allow you to amplify the entire DNA fragment .. 5' TACTCATTTAACTATGACGCTGTAACTTGT - 3' 3' ATGAGTAAATTGATACTGCGACATTGAACA - 5' High heat: breaks hydrogen bonds between nucleotides holding strands together Heat: also
Image of page 1

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern