ps1answers - Genome 371 Spring, 2005 Review of Central...

Info iconThis preview shows pages 1–4. Sign up to view the full content.

View Full Document Right Arrow Icon
Genome 371 Spring, 2005 Review of Central Dogma; Simple Mendelian Inheritance Problem Set #1 Answers: 1. 5'-ACCGTTATGAC-3' 2. No. You would also need to know if this organism has a double stranded DNA genome. Assuming that it does have a double stranded genome, G+C = 44%, and A+T = 56%. Thus, 28% of the bases would be adenine. 3. No. tobacco mosaic virus has a single stranded RNA genome and thus, the base-pair stoichiometry of DNA does not apply. 4. (a). double-stranded DNA (b) . Double-stranded RNA (c). Single-stranded RNA 5. (a). False (b). False (c). True (d). True (e). True (f). True (g). True (h). True (i). True (j). False (k). False (l). True (m). True 6. Molecule II will have the higher T m . Thermal vibrations from heat can disrupt hydrogen bonds and base stacking interaction, the major forces that hold the two strands of a DNA duplex together. Molecule II has more GC base pairs than molecule I: 10 of 15 compared to 4 of 15. GC base pairs have three H-bonds compared to the two of AT base pairs. In addition, adjacent GC base pairs have greater stacking energy than adjacent AT base pairs. Therefore, more thermal energy will be required to separate the strands of a DNA molecule with a higher percent of GC. 7. (a). 2 (b). 10 (c). 8
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Genome 371 Spring, 2005 (d). 12 (e). 6 (f). 5 (g). 9 (h). 14 (i). 3 (j). 13 (k). 1 (l). 7 (m). 15 (n). 11 (o). 4 8. 5' 5' 3' 3' Gene F Gene G template strand for transcription of gene G template strand for transcription of gene F 9. Three. 5’C)(TTA)(CAG)(TTT)(ATT)(GAT)(ACG)(GAG)(AAG)(G3’ 5’CT)(TAC)(AGT)(TTA)(TTG)(ATA)(CGG)(AGA)(AGG)3’ 3’(GAA)(TGT)(CAA)(ATA)(ACT)(ATG)(CCT)(CTT)(CC5’ 10. Transcription: Adding the appropriate ribonucleotide complementary to the template. Translation: codon in mRNA and anticodon in tRNA are complementary.
Background image of page 2
Genome 371 Spring, 2005 11. (a). Each amino acid is specified by a codon. A codon consists of three nucleotides. Therefore, there must be at least 477X3=1431nucleotides in the coding part of this yeast gene. (b). Since this sequence derives from the middle of the coding region it must contain an open reading frame that extends through the entire sequence. There are six possible reading frames (including the complementary strand, which we can easily derive) and only one contains an open reading frame (the complementary strand) that extends through the entire sequence: 5’A)(CCC)(TGG)(ACT)(AGT)(CGA)(AAG)(TTA)(ACT)(TAC)3’ The corresponding amino acid sequence would be: ?-Pro-Trp-Thr-Ser-Arg-Lys-Leu-Thr-Tyr. (c). The sequence must correspond to that in which the complete open reading frame exists: 5’ACCCUGGACUAGUCGAAAGUUAACUUAC3’ 12. (a). Using the genetic code in the Table, there are eight cases in which knowing the first two nucleotides does not tell you the specific amino acid. (b).
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 4
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 06/03/2008 for the course GENOME 371 taught by Professor Unsure during the Spring '03 term at University of Washington.

Page1 / 9

ps1answers - Genome 371 Spring, 2005 Review of Central...

This preview shows document pages 1 - 4. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online