Lecture 12 Bio325 Fall 07

Lecture 12 Bio325 Fall 07 - What is the relationship...

Info iconThis preview shows pages 1–4. Sign up to view the full content.

View Full Document Right Arrow Icon
1 What is the relationship between DNA sequence and protein sequence? critical experiment by Yanofsky in 1964 Fig. 8.4 • nucleotides are colinear with amino acids • a nucleotide affects only one amino acid • an amino acid must be encoded by more than one nucleotide How many nucleotides specify an amino acid? critical experiments by Crick and Brenner, 1955 Fig. 8.5
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
2 1 chromosome = 1 DNA helix (2 strands) each chromosome can contain many genes, which are defined by their DNA sequence Fig. 8.2 DNA RNA PROTEIN • Genes account for only a small percentage of the total DNA on a eukaryotic chromosome • In general, a gene “encodes” a single polypeptide (protein) = a gene centromere Gene : A hereditary unit consisting of a sequence of DNA that occupies a specific location on a chromosome and determines a particular characteristic in an organism. • The code present in DNA is first transcribed into an RNA message (mRNA) ATGACGTATAGCAGGGACCGATCACAGCGATACAGT TACTGCATATCGTCCCTGGCTAGTGTCGCTATGTCA AUGACGUAUAGCAGGGACCGAUCACAGCGAUACAGU 5 3 CHROMOSOME mRNA: GGCAGGCACT CCGTCCGTGA ATAGGTCCAGT TATCCAGGTCA template strand non-template strand TRANSCRIPTION: TRANSLATION: • The mRNA is then translated into a polymer of amino acids (a polypeptide, protein) AUGACGUAUAGCAGGGACCGAUCACAGCGAUACAGU 5 3 mRNA: Met Thr Tyr Ser Arg Asp Arg Ser Gln Arg Tyr Ser protein:
Background image of page 2
• each 3 nucleotides code for 1 amino acid; each triplet of nucleotides is called a codon • a string of amino acids is a polypeptide (protein ) AUGACGUAUAGCAGGGACCGAUCACAGCGAUACAGU 5 3 mRNA: Met Thr Tyr Ser Arg Asp Arg Ser Gln Arg Tyr Ser protein: • all organisms characterized on earth use the same genetic code for the translation of RNA into protein • there are 64 different codons (4 3 ) but only 20 amino acids, therefore some amino acids can be translated from several different codons • three codons (UAA, UAG, and UGA) code for translation STOP • AUG (methionine) is always the first codon in a gene Fig. 8.3 • the third nucleotide in a codon (the wobble base) shows less specificity Genetic Code: Every protein is a polymer of amino acids
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 4
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 06/19/2008 for the course BIO 325 taught by Professor Saxena during the Fall '08 term at University of Texas.

Page1 / 11

Lecture 12 Bio325 Fall 07 - What is the relationship...

This preview shows document pages 1 - 4. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online