Discovery Questions Chapter 2

Discovery Questions Chapter 2 - PREDICTED Ornithorhynchus...

Info icon This preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
Megan Lawless Discovery Questions Chapter 2 1. 5’ GGGCTCAGCTGTATCAGCCACGTGCCTACAACAATCTGCCCCT 3’ 3’ CCCGAGTCGACATAGTCGGTGCACGGATGTTGTTAGACGGGGA 5’ Result for top strand: Chlamydomonas reinhardtii ezy-1 mRNA, complete cds Result for bottom strand: Mus musculus BAC clone RP23-251N2 from chromosome 18, complete sequence 3,4,5. Best match for first 30:
Image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: PREDICTED: Ornithorhynchus anatinus similar to Lamin-B1 (LOC100075114), mRNA (E-value= .77) Best match for first 50: Thalassiosira weissflogii sexually induced protein 1 (Sig1) mRNA, complete cds (E-value= 2e-09) 7. Amphibians- it seems that if mammals evolved later that they might have larger and presumably more complex genomes...
View Full Document

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern