{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

Discovery Questions Chapter 2

Discovery Questions Chapter 2 - PREDICTED Ornithorhynchus...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
Megan Lawless Discovery Questions Chapter 2 1. 5’ GGGCTCAGCTGTATCAGCCACGTGCCTACAACAATCTGCCCCT 3’ 3’ CCCGAGTCGACATAGTCGGTGCACGGATGTTGTTAGACGGGGA 5’ Result for top strand: Chlamydomonas reinhardtii ezy-1 mRNA, complete cds Result for bottom strand: Mus musculus BAC clone RP23-251N2 from chromosome 18, complete sequence 3,4,5. Best match for first 30:
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: PREDICTED: Ornithorhynchus anatinus similar to Lamin-B1 (LOC100075114), mRNA (E-value= .77) Best match for first 50: Thalassiosira weissflogii sexually induced protein 1 (Sig1) mRNA, complete cds (E-value= 2e-09) 7. Amphibians- it seems that if mammals evolved later that they might have larger and presumably more complex genomes...
View Full Document

{[ snackBarMessage ]}

Ask a homework question - tutors are online