Lecture_16_Gray_08

Lecture_16_Gray_08 - MUTATION Lecture 16 Phenotypic Effects...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: MUTATION Lecture 16 Phenotypic Effects can be Mapped to Particular Loci on Chromosomes "normal" (wild type) Drosophila melanogaster I. What is mutation? II. Types of mutations III. Frequency of mutations Reduced wings mutant Mutation = Any change in the genetic material of a cell or virus White eye mutant Mutation is the ultimate source of all genetic variation Mutation provides the raw material for evolution. Ebony mutant Without mutation there would be no alleles (variants of a particular gene) Eyeless mutant Mutation = Any change in the genetic material of a cell or virus MUTATION = Any change in the genetic material of a cell or virus II. Types of mutations Large Scale Changes (chromosomes) Polyploidy - entire set of chromosomes duplicated +++++++ Chromosome number changes +++ or - - Chromosome structural changes deletions - duplications ++ inversions = translocations = Smaller Changes (one or a few nucleotides) Single base pair substitutions Silent = Missense = Nonsense = Insertions of one or a few base pairs Frameshift Multiple of 3 base pairs Deletions of one or a few base pairs Frameshift Multiple of 3 base pairs CHROMOSOMAL MUTATIONS (Polyploidy) Haploid = one set of chromosomes in the cell (1n) Diploid = 2 sets of chromosomes in the cell, one from each parent (2n) Polyploid = offspring Oenothera gigas (4n = 28) + -thousands of plant species are polyploid -not common in Invertebrate animals - -very rare in vertebrate animals CHROMOSOMAL MUTATIONS (Number) Mutations in the number of chromosomes (including polyploidy) are generally due to errors In meiosis and mitosis. CHROMOSOMAL MUTATIONS (Number) Down Syndrome Figure 15.15 3 copies of chromosome 21 Figure 15.12 Having too many (or too few) chromosomes can have diverse effects on organisms' phenotypes. Phenotype = the physical and physiological characteristics of an organism. CHROMOSOMAL MUTATIONS (Structure) Large Scale Changes (chromosomes) Polyploidy - entire set of chromosomes duplicated ** Chromosome number changes ** Chromosome structural changes deletions duplications ** inversions translocations **cause of gene duplications Chromosome breakage during cell division can lead to chromosomes that lack segments, have duplicated segments, have inverted segments, or have additional segments added from non-homologous chromosomes Figure 15.14 MUTATIONS (small changes) DNA is transcribed into mRNA, and triplets of nucleotides in the mRNA encode particular amino acids. The "universal" genetic code is redundant because there are 64 codons (4x4x4) and only 20 amino acids. This makes some single base-pair mutations "silent." Hemoglobin (4 subunits) There are several globin genes within a single mammalian genome (human is shown). Gene duplication results in offspring that have multiple copies of the same gene. Because these duplicated genes are instantly functional (a new gene doesn't have to be built from scratch), gene duplication that is due to chromosomal rearrangements provides important raw material for future evolutionary changes. Some gene "families," such as olfactory receptors include 100s of highly similar gene copies that are thought to be derived from a single ancestral olfactory receptor gene. Each olfactory receptor gene is slightly different and binds different airborne chemicals. See Figure 17.5 NUCLEOTIDE (base pair) SUBSTITUTION "silent" mutation missense mutation A single nucleotide substitution in the Le gene causes a single amino acid change that reduces the production of a plant growth hormone nonsense mutation tall Figure 17.24 dwarf Frameshift mutations in these genes produce dental disorders in humans. INSERTIONS / DELETIONS (short ones) "Tooth" Genes Ameloblastin (AMBN) Enamelin (ENAM) AMBN Dolphin Hippo Cow Pig Camel Dog Human Mouse Rat Function enamel formation enamel formation Amelogenesis Imperfecta frameshift CCCGGCCTTGGAGGGATGCCCTCCAATCCAGCCATGGGCGGGGACTTTACTCTGGAATTTGACTCCCCAG ...A.G...............C................................................ ...A.G...............CA...C....A......T............................... ...AA................C....CT......A...T.................G............. T..AA................A..........A.....A...........A................... ..TAA................CA........G...................................... ......T...AG..A......CA...C.....T........T.....C...................... .AAAC....A.GA.AC..AATCAG...T..C...A...A..A.........G.....G.A..T....... .AAAC....A.G..AC..AATCAG...T..C...A...A..A.........G.....G.A..T..T.... frameshift ENAM Dolphin Hippo Cow Pig Camel Dog Human/Chimp Mouse Rat AACCAACAAGAAATCTCTCCACCTTTTAAGGAAGATCCTGGAAGGCATGAAGAACACTTACCTCATCCTT ....................G..........................G...................... .............................................A.G...................... T ..T..........................A...........G.....G...................T.. .........................................G.A...G............T......T.. C.T..C...............T...................G.....G..G....T........C..... G....C................................A..G.....A........T.....C....... ..T.GT...A.....CT......C..A........CTA...G.....A..C...A.T....G......G. ..T..C...A...C.CT...G..C..A..A....GC.A...G...A.A......A.T....G.......C Insertions/deletions that are multiples of 3 do not cause frameshift Figure 17.25 Mutation supplies the raw material for evolution Balaenoptera acutorostrata (baleen whale). insertion of one nucleotide Ameloblastin (AMBN) Baleen Whale Dolphin Hippo Cow Pig Camel Dog Human Mouse Rat CCCGGCCTTGGAGGGATGCCCCCCCAATCCAGCCATGGGCGGGGACTTTACTCTGGAATTTGACTCCCCAG CCCGGCCTTGGAGGGATGCCCTCC AATCCAGCCATGGGCGGGGACTTTACTCTGGAATTTGACTCCCCAG CCCAGGCTTGGAGGGATGCCCCCC AATCCAGCCATGGGCGGGGACTTTACTCTGGAATTTGACTCCCCAG CCCAGGCTTGGAGGGATGCCCCAC AACCCAGACATGGGTGGGGACTTTACTCTGGAATTTGACTCCCCAG CCCAACCTTGGAGGGATGCCCCCC AACTCAGCCAAGGGTGGGGACTTTACTCTGGAGTTTGACTCCCCAG TCCAACCTTGGAGGGATGCCCACC AATCCAGCAATGGGAGGGGACTTTACACTGGAATTTGACTCCCCAG CCTAACCTTGGAGGGATGCCCCAC AATCCAGGCATGGGCGGGGACTTTACTCTGGAATTTGACTCCCCAG CCCGGCTTTGAGGGAATGCCCCAC AACCCAGCTATGGGCGGTGACTTCACTCTGGAATTTGACTCCCCAG CAAACCCTTAGGAGACTGAATCAG AATTCACCCAAGGGAGGAGACTTTACTGTGGAAGTAGATTCCCCAG CAAACCCTTAGGGGACTGAATCAG AATTCACCCAAGGGAGGAGACTTTACTGTGGAAGTAGATTCTCCAG Balaenoptera acutorostrata (baleen whale - living) deletion of one nucleotide Enamelin (ENAM) Adult baleen whales have brush-like structures in their mouth to strain small crustaceans (krill), but do not have mineralized teeth with enamel. These animals have no teeth as adults and do not produce enamel. Would you expect these whales to have tooth genes? Baleen Whale Dolphin Hippo Cow Pig Camel Dog Human Mouse Rat AACCAACAAGAAATCTCTCCACCTTT AAGGAAGATCCTGGAAGGCATGAAGAACACTTACCTCATCCTTC AACCAACAAGAAATCTCTCCACCTTTTAAGGAAGATCCTGGAAGGCATGAAGAACACTTACCTCATCCTTC AACCAACAAGAAATCTCTCCGCCTTTTAAGGAAGATCCTGGAAGGCAGGAAGAACACTTACCTCATCCTTC AACCAACAAGAAATCTCTCCACCTTTTAAGGAAGATCCTGGAAGGAAGGAAGAACACTTACCTCATCCTTC AATCAACAAGAAATCTCTCCACCTTTTAAAGAAGATCCTGGGAGGCAGGAAGAACACTTACCTCATCTTTC AACCAACAAGAAATCTCTCCACCTTTTAAGGAAGATCCTGGGAAGCAGGAAGAACACTTATCTCATCTTTC CATCACCAAGAAATCTCTCCATCTTTTAAGGAAGATCCTGGGAGGCAGGAGGAACTCTTACCTCCTCCTTC GACCACCAAGAAATCTCTCCACCTTTTAAGGAAGATCCAGGGAGGCAAGAAGAACATTTACCCCATCCTTC AATCGTCAAAAAATCCTTCCACCCTTAAAGGAAGACTATGGGAGGCAAGACGAAAATTTACGTCATCCGTC AATCACCAAAAAACCCTTCCGCCCTTAAAAGAAGGCCATGGGAGGAAAGAAGAAAATTTACGTCATCCTCC Living baleen whales do not produce enamel but have genes that are critical to the production of enamel in other mammals. The enamel-specific genes (ameloblastin and enamelin) have many short insertions and deletions that cause frameshifts and premature stop codons (presumably because the enamel-specific genes are not functional any more). Frequency and Effects: Human (Homo sapiens) Frequency: Escherichia coli bacteria (inside colon of H. sapiens) MUTATION III. Frequency of mutations MUTATION III. Frequency of mutations E. coli mutation rate = 1 x 10-7 mutations / gene / cell division (1 in 10 million) 1) 2) 3) 4) 5) 6) 7) ~10 novel mutations per newborn baby Most are single base pair substitutions and small insertions or deletions of base pairs Most mutations occur in stretches of DNA that do not encode proteins 2 x 1010 new cells / day / colon (20 billion cells) ~2000 mutations / gene /day in the population !! ~0.1 to 2 phenotypically detectable mutations per human Most phenotypically detectable mutations are deleterious Mutations must be in gametes to be passed on to next generation Mutation is thought to be random relative to the needs of the organism ~4300 genes / genome (4.6 million base pairs) ~9 million mutations / day / colon !!! Many mutants pass on to next generation but random relative to needs of the bacteria ...
View Full Document

Ask a homework question - tutors are online