
08_Quiz_4_with_answers - σ 2 domain of the σ 70 protein C...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
5' - CACTTTTCTGTAGTATTTGACCTAATTTCACTTAAGGAATATTATAGAACCAGA -3 ' 3' - GTGAAAAGACATCATAAACTGGATTAAAGTGAATTCCTTATAATATCTTGGTCT -5 ' A B C E D The nucleotide sequence shown below contains the elements of σ 70 promoters shown in boxes labeled A – E . Associate each of the statements provided under numbers 1 – 8 with the corresponding element (box) of such promoters. B 1. 35 region. D
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: σ 2 domain of the σ 70 protein. C 3 . Binding site for the σ 3 domain of σ 70 . E 4. Potential transcription initiation sites. A 5. Binding site for the C-terminal domains of α-subunits ( α CTDs) of the RNA polymerase. D 6. − 10 region. A 7. UP region. B 8. Binding site for the σ 4 domain of σ 70 . MMG 431 -Quiz 4 October 1, 2008 W: 3.24 of 8 C: 2.57 of 8...
View Full Document

This note was uploaded on 04/08/2009 for the course MMG 431 taught by Professor Bertrand during the Summer '08 term at Michigan State University.

Ask a homework question - tutors are online