
FinalPractice2 - Name ID BIS101-001 Simon Chan Winter 2008...

Info iconThis preview shows pages 1–4. Sign up to view the full content.

View Full Document Right Arrow Icon
Name: ______________________________                          ID: _______________________________ BIS101-001 Simon Chan Winter 2008 Final Exam Practice #2 Note that our class covers slightly different material from previous BIS101 offerings. Therefore, this practice exam may contain a limited number of questions that you would not be expected to answer in the actual final. This exam has a total of 160 points READ THE QUESTIONS CAREFULLY BEFORE YOU ANSWER. SHOW ALL WORK TO GET FULL CREDIT. 1. (20 points total /2 pts each) For each phrase on the left, choose the number of the best matching term on the right. a. (T to C) or (A to G) mutations are ___________________ 1. mismatch repair 2. photoreactivation repair protein b. Polymerase that is error prone ___________________________ 3. transitions 4. forming purine dimmers 5. transversions c. The repair system that creates new DNA_________________ 6. forming pyrimidine dimers 7. Photolyase d. (T to A) or (G to T) mutations are _____________________ 8. error primed repair 9. transcription mutations e. Ultraviolet light primarily damages DNA by ______________ 10. gap repair 11. excision repair f. The protein that uses light to directly repair DNA is ________________ 12. alkylating DNA 13. TTAGAAGAAGAAGAAGAACTT g. This sequence could cause slipped mispairing ___________________14. endoreduplication repair 15. SOS repair h. Slipped mispairing could cause an indel in any___________________ 16. microsatellite 17. TTATCGATGCTACGTT i. This is important to prevent mutations during replication ____________18. p53 protein 19. DNA Polymerase j. Mutations in this repair system lead to Colon Cancer ______________ 20. TAQ DNA Polymerase 21. spoofreading repair 2. We discussed two major classes of cancer mutations that are being studied. What are these two classes and how do they fit into the idea of Mendelian idea of dominant and recessive? Give one example of each and state which of the three cancer preventing biological processes that your example affects (16 points). Mutation Class 1 – 1
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Name: ______________________________                          ID: _______________________________ Mutation Class 2 – 2
Background image of page 2
Name: ______________________________                          ID: _______________________________ 3. A researcher and her relatives are studying the genetic linkage for three traits in Giant Sequoia. All three traits are known to be on the largest autosomal chromosome The three traits are Green needles versus Yellow Needles (G v g), Black versus Brown bark (B v b) and Round versus Oval trunks (R v r). Green needles are
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 4
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

Page1 / 11

FinalPractice2 - Name ID BIS101-001 Simon Chan Winter 2008...

This preview shows document pages 1 - 4. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online