FinalPractice2Key

FinalPractice2Key - Name: ______________________________ ID:

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Name: ______________________________ ID: _______________________________ BIS101-001 Simon Chan Winter 2008 Final Exam Practice #2 Key Note that our class covers slightly different material from previous BIS101 offerings. Therefore, this practice exam may contain a limited number of questions that you would not be expected to answer in the actual final. This exam has a total of 160 points READ THE QUESTIONS CAREFULLY BEFORE YOU ANSWER. SHOW ALL WORK TO GET FULL CREDIT. 1. (20 points/ 2 points per line) For each phrase on the left, choose the number of the best matching term on the right. a. (T to C) or (A to G) mutations are _______ 3 _____________ 1. mismatch repair 2. photoreactivation repair protein b. Polymerase that is error prone __________ 20 _________________ 3. transitions 4. forming purine dimers c. The repair system that creates new DNA_______ 15 __________ 5. transversions 6. forming pyrimidine dimers 7. Photolyase d. (T to A) or (G to T) mutations are _______ 5 ______________ 8. error primed repair 9. transcription mutations e. Ultraviolet light primarily damages DNA by _____ 6 _________ 10. gap repair 11. excision repair f. The protein that uses light to directly repair DNA is_______ 7 ________ 12. alkylating DNA 13. TTAGAAGAAGAAGAAGAACTT g. This sequence could cause slipped mispairing __________ 13 _______14. endoreduplication repair 15. SOS repair h. Slipped mispairing could cause an indel in any__________ 16 _______ 16. microsatellite 17. TTATCGATGCTACGTT i. This is important to prevent mutations during replication _____ 19 _____18. p53 protein 19. DNA Polymerase j. Mutations in this repair system lead to Colon Cancer _______1______ 20. TAQ DNA Polymerase 21. spoofreading repair 2. We discussed two major classes of cancer mutations that are being studied. What are these two classes and how do they fit into the idea of Mendelian idea of dominant and recessive? Make sure to state what the dominant or recessive nature of the mutation suggests about the genes original function. Give one example of each and state which of the three cancer preventing biological processes that your example affects (16 points). Mutation Class 1 One type of cancer mutation is the tumor suppressor mutation. This mutation is typically recessive suggesting that the wildtype copy functions to suppress cancerous cells . Examples would include Rb or p53, both of which block the cell cycle. In addition, p53 can trigger apoptosis. 1 Name: ______________________________ ID: _______________________________ Mutation Class 2 The second major class of cancer mutation is the oncogenic mutation . This is a dominant gain-of-function mutation that leads to cancerous growth. Because it is dominant, it is not possible to deduce the wildtype function of these genes. Examples would be the growth factor receptor or BCR2 that function to block apoptosis....
View Full Document

Page1 / 9

FinalPractice2Key - Name: ______________________________ ID:

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online