MBIO 3410 lecture Oct 16 2007

MBIO 3410 lecture - Last lecture overview Selectable Markers Ampicillin Tetracycline Chloramphenicol Kanamycin Neomycin Streptomycin Uses for

Info iconThis preview shows pages 1–6. Sign up to view the full content.

View Full Document Right Arrow Icon
1 Last lecture - overview Selectable Markers Ampicillin Tetracycline Chloramphenicol Kanamycin Neomycin Streptomycin Uses for vectors General cloning Shuttle vectors RNA production Protein production Expression vectors Vectors without using restriction enzymes Cre recombinase Plasmids shortcomings Protein synthesis Genetic code rRNA processing in prokaryotes rRNA processing in eukaryotes Mammalian pre-rRNA Prokaryotic ribosomes Eukaryotic ribosomes tRNA tRNA processing in prokaryotes in eukaryotes tRNA primary structure tRNA secondary structure tRNA tertiary structure Aminoacylation of tRNA Aminoacyl-tRNA synthase
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
2 Topoisomerase: Alter the level of supercoiling of DNA by breaking one or both strands of the DNA backbone: Type I : break one strand of DNA and pass the other strand through the break (change Lk by ± 1) Type II : (via ATP) break both strands of DNA and pass another segment of dsDNA through the break (change Lk by ± 2) • Ex. DNA gyrase introduces –ve supercoiling (in bacteria) during replication to counteract the +ve supercoiling that occurs in this process
Background image of page 2
3 Examples for T m Calculations Basic T m Calculation: T m = 4°C x (number of G’s and C’s) + 2°C x (number of A’s and T’s) This formula is valid for short oligos (15-30 bases long) and assumes that the reaction is carried out in the presence of 50 mM monovalent cations Salt-Adjusted Tm Calculations: Another commonly used formula takes into account the salt concentration Tm = 81.5°C + 16.6°C x (log10[Na+] + [K+]) + 0.41°C x (%GC) 675/N Where N is the number of nucleotides in the oligo Using TAATACGACTCACTATAGGG as an example in PCR with 50 mM monovalent cation concentration, its Tm is calculated: 81.5°C + 16.6°C x (log10[0.05]) + 0.41°C x (40) 675/20 = 42.5°C
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
4 Aspects of protein synthesis
Background image of page 4
Anticodon at the end of of the
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 6
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 07/05/2008 for the course MBIO 3410 taught by Professor Richardson during the Fall '07 term at Manitoba.

Page1 / 22

MBIO 3410 lecture - Last lecture overview Selectable Markers Ampicillin Tetracycline Chloramphenicol Kanamycin Neomycin Streptomycin Uses for

This preview shows document pages 1 - 6. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online