bicdpracticefinal

bicdpracticefinal - Thalassemia results in the under...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Thalassemia results in the under production of globin protein, often through mutations in regulatory genes, or structural abnormalities in the globin proteins themselves. The two conditions may overlap, however, since some conditions which cause abnormalities in globin proteins also affect their production. Either or both of these conditions may cause anemia. The following mRNA codes for normal globin protein structure and production: Consult a Codon Usage Table in your text to answer the following questions. 5’(cap) – AAACCAUAUAUGCGAUAUGCUUUUAUGAUUGAGUAAAACCAAAAA – 3’ 1. The N terminal amino acid in the protein translated from the mRNA above would be: a. Arg b. Met c. Lys d. Glu e. some other amino acid 2. The second amino acid in the globin protein would be: a. Arg b. Phe c. Met d. Glu e. some other amino acid 3. The C terminal amino acid in the globin protein would be a. Arg b. Phe c. Met d. Glu e. some other amino acid 4. The total number of amino acids in the completed globin protein would be: a. 4 b. 8 c. 12 d. 15 e. none of the above Indicate whether the following statements (5 through 9) about the structure of DNA are true or false. (A=True; B=False) 5. A+T = G+C B 6. A=G; C=T B 7. A/T=C/G A 8. A+G = C+T A 9. G/C=1 A The following figure represents a small portion of the non-template strand of a piece of DNA. 5’ ATGTTCAGTGCCATTGCTACTGGCTAA 3’ 10. Using the strand of DNA given, what is the mRNA? a. 5’ ATGTTCAGTGCCATTGCTACTGGCTAA 3’ b. 5’ AAUCGGUCAUCGUUACCGUGACUUGUA 3’ c. 5’ AUGUUCAGUGCCAUUGCUACUGGCUAA 3’ d. 3’ AUGUUCAGUGCCAUUGCUACUGGCUAA 5’ e. None of the above 11. Using the amino-acid codon table on the very last page of the exam, what amino acids make up this piece of DNA? a. MET-PHE-SER-ALA-ILE-ALA-THR-GLY-STOP b. MET-SER-THR-GLY-ALA-PHE-PHE-GLY-STOP c. SER-MET-GLY-ALA-GLU-THR-VAL-STOP-MET d. None of the above e. 2 of the above are possible.
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
12. If guanine was inserted after the 3 rd base in the sequence given, how would this affect the amino acids? a. They would not change at all b. There would be a shift in the reading frame c. One would change to VAL d. It would change to a nonsense mutation e. Both b and c 13. Which of the following is NOT true in regards to transcription? a. DNA is transcribed into mRNA, which can leave the nucleus. b. tRNA can go through alternative splicing to obtain different combinations of exons which in turn can lead to different types of proteins. c.
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 09/12/2008 for the course BICD 100 taught by Professor Nehring during the Summer '08 term at UCSD.

Page1 / 6

bicdpracticefinal - Thalassemia results in the under...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online