{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

bicdpracticefinal

bicdpracticefinal - Thalassemia results in the under...

Info icon This preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Thalassemia results in the under production of globin protein, often through mutations in regulatory genes, or structural abnormalities in the globin proteins themselves. The two conditions may overlap, however, since some conditions which cause abnormalities in globin proteins also affect their production. Either or both of these conditions may cause anemia. The following mRNA codes for normal globin protein structure and production: Consult a Codon Usage Table in your text to answer the following questions. 5’(cap) – AAACCAUAUAUGCGAUAUGCUUUUAUGAUUGAGUAAAACCAAAAA – 3’ 1. The N terminal amino acid in the protein translated from the mRNA above would be: a. Arg b. Met c. Lys d. Glu e. some other amino acid 2. The second amino acid in the globin protein would be: 3. The C terminal amino acid in the globin protein would be 4. The total number of amino acids in the completed globin protein would be: Indicate whether the following statements (5 through 9) about the structure of DNA are true or false. (A=True; B=False) 5. A+T = G+C B 6. A=G; C=T B 7. A/T=C/G A 8. A+G = C+T A 9. G/C=1 A The following figure represents a small portion of the non-template strand of a piece of DNA. 5’ ATGTTCAGTGCCATTGCTACTGGCTAA 3’ 10. Using the strand of DNA given, what is the mRNA? a. 5’ ATGTTCAGTGCCATTGCTACTGGCTAA 3’ b. 5’ AAUCGGUCAUCGUUACCGUGACUUGUA 3’ c. 5’ AUGUUCAGUGCCAUUGCUACUGGCUAA 3’ d. 3’ AUGUUCAGUGCCAUUGCUACUGGCUAA 5’ e. None of the above 11. Using the amino-acid codon table on the very last page of the exam, what amino acids make up this piece of DNA?
Image of page 1

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
12. If guanine was inserted after the 3 rd base in the sequence given, how would this affect the amino acids?
Image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern