Translation

Translation - BILD1 Lecture 18 Translation Central dogma...

Info iconThis preview shows pages 1–8. Sign up to view the full content.

View Full Document Right Arrow Icon
BILD1 Lecture 18 5/29/08 Translation
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Central dogma of biology Transcription Translation Replication DNA RNA Protein
Background image of page 2
Translation: mRNA Protein mRNA sequence of bases determines protein amino acid sequence DNA molecule Gene 1 Gene 2 Gene 3 DNA strand (template) TRANSCRIPTION mRNA Protein TRANSLATION Amino acid A C C A A A C C G A G T U G G U U U G G C U C A Trp Phe Gly Ser Codon 3’ 5’ 3’ 5’
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Molecular Components of Translation Ribosomes - Big complexes of both ribosomal RNA and protein - Translates mRNA message 5’ 3’ into protein - Uses transfer RNA (tRNA ) to add amino acids 64 different codon triplets possible in mRNA specify 20 amino acids and polypeptide ends (“start”, “stop”) DNA template A C G T A C G T A mRNA 5’ - U G C A U G C A U - 3’ Polypeptide Cys Met His
Background image of page 4
Cracking the Code Codons in messenger RNA are either - translated into an amino acid or - serve as a translational “stop” signal Second mRNA base U C A G U C A G UUU UUC UUA UUG CUU CUC CUA CUG AUU AUC AUA AUG GUU GUC GUA GUG Met or start Phe Leu Leu lle Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UAC UGU UGC Tyr Cys CAU CAC CAA CAG CGU CGC CGA CGG AAU AAC AAA AAG AGU AGC AGA AGG GAU GAC GAA GAG GGU GGC GGA GGG UGG UAA UAG Stop Stop UGA Stop Trp His Gln Asn Lys Asp Arg Ser Arg Gly U C A G U C A G U C A G U C A G First mRNA base (5’ end) Third mRNA base (3’ end) Glu
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
The story of the stop codons These are the “names” of the three stop codons: UAG -> amber UGA -> opal UAA -> ochre "Amber" was named by the discoverers after their friend Harris Bernstein, whose last name means "amber" in German. The other two stop codons were named “ochre" and "opal" in order to keep the color theme.
Background image of page 6
Find the protein 5’AGCAGCTCATGGGCGTATTTGCGCTAGTGTTGGGTGTTCCG CTGTGCTGTTTTTCCGTCATGGCTCGCACTAAGCAAACTGCTC GGAAGTCTACTGGTGGCAAGGCGCCACGCAAACAGTTGGCCA CTAAGGCAGCCCGCAAAAGCGCTCCGGCCACCGGCGGCGTG AAAAAGCCCCACCGCTACCGGCCGGGCACCGTGGCTCTGCGC
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 8
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 09/27/2008 for the course BILD 1 taught by Professor Boulanger during the Spring '08 term at UCSD.

Page1 / 26

Translation - BILD1 Lecture 18 Translation Central dogma...

This preview shows document pages 1 - 8. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online