{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

Lecture+3+DOGMA - HOMEWORK Design 6-mer primers to use in a...

Info iconThis preview shows pages 1–11. Sign up to view the full content.

View Full Document Right Arrow Icon
HOMEWORK: Design 6-mer primers to use in a PCR reaction to amplify the DNA sequence shown in red : 5‘-ATTCGGAT TACATCGGCATTACCGATTTAAAG CCCTTAACG-3' 3’-TAAGCCTA ATGTAGCCGTAATGGCTAAATTTC GGGAATTGC-5' 5’-TACATC-3’ 3’-AATTTC-5’ 5’-CTTTAA-3’ (Please report both your answers in the 5’ to 3’ orientation) What is the Tm of each of these primers? 5’-TACATC-3’, Tm=16°C 5’-CTTTAA-3’, Tm=14 ° C ANSWER:
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
What would happen to your PCR reaction if you omitted one of the primers (used just a “forward” primer or just a “reverse” primer)? 2-21
Background image of page 2
CYCLE 1 2 3 2-22
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
CYCLE COPIES 1 2 1 =2 2 2 2 =4 3 2 3 =8 2-23
Background image of page 4
2 25 = 33.5 x 10 6 !! 2-24
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Applications of PCR Pre-implantation genetic diagnosis as an application of PCR Forensics (the Innocence Project) Screening blood products for diseases Viral infections in wild monkeys by collecting feces—which dog pooped on your lawn Cloning Neanderthal genes 2-26
Background image of page 6
The Central Dogma explains how DNA becomes a phenotype DNA transcription RNA translation protein 3-1
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Proteins give us our phenotype Enzymes and many structural components of cells are made up of protein. Proteins determine how we function and how we look. DNA controls our phenotype by encoding proteins. 3-2
Background image of page 8
The conversion of a gene into a protein through an RNA intermediate is called GENE EXPRESSION Gene expression is highly regulated and cell type-specific 3-3
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
A liver cell encounters a toxin in the bloodstream.
Background image of page 10
Image of page 11
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}