BIMM 100 - pillus practice final

BIMM 100 - pillus practice final - Name Practice Final H...

Info iconThis preview shows pages 1–21. Sign up to view the full content.

View Full Document Right Arrow Icon
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 2
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 4
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 6
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 8
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 10
Background image of page 11

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 12
Background image of page 13

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 14
Background image of page 15

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 16
Background image of page 17

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 18
Background image of page 19

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 20
Background image of page 21
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Name Practice Final H thalfiLe'la/t’ be; Please write your name on each page and look through the entire exam before beginning your answers. Your exam should have 12 pages. The exam has a total of 9 questions. Be certain to answer every question as directed. Please do not use pencil or white-out on your exam. Be certain that all of the work yourvantgradedisxvfiuenin pennanentink. Note that all sequences are presented in 5‘ -> 3' orientation and that a codon table and a restrietion enzyme table have been pmvided as the last page of your exam. iiThis practice exam does not include the cotlon table from the MCB text (see p. IZR l'or codon table). Your score 1. 32 pts. 2. 18 pts. 3. 4 pts. 4. 6 pts. 10 pts. 18 pts. 5 6 7. 44pts. 8 14pm 9 34 pts. Total 180 pts. 2 Ham; __ l. (4 pts each/32 pts total). Circle the number corresponding to the correct response for the questions on this page and the next. A. Splicing of pol II transcribed RNAs joins 1. two intron sequences two nascent transcripts two DNA molecules tWO CXOHS 9'95".“ adjacent functional domains in proteins B. Which anticodon in tRNA recognizes the start codon in translation? 1. UAC 2. AUG 3. GUA 4. CAU 5. UGA C. Which of the following is a ribozyme-mediated process? 1. excision of group II introns 2. trans-splicing 3. RNA editing in intestinal tissue 4. excision of group III introns 5. splicing of pol III transcripts D. Which of the following is M used in DNAse I footprinting? l. a radioactively labeled DNA fragment 2. a nitrocellulose filter 3. DNA binding protein(s) 4. DNAseI wvssnsoousm ~ ‘ not lunu'mlwmm'pson'qawmemmduq 939d mm 3 Name ._.__.___ 1. (cont’d. 4 pts each/32 pts total). Circle the number corresponding to the correct response. E. Which of the following is a protein that is required for translation? 1. pcptidyltransferase 2. RNA polymerase 3. ribosomal RNA 4. 0'“ 5. aminoacyl-tRN A synthetase F. Which of the following substitutions could occur as a result of a single base change in the methionine codon? l. Asp Arg Ala Ser S-"PP!" Stop G. Which does not occur within the nucleus? 1. ribosomc subunit assembly 2. debranching of excised lariat introns 3. 5' de-eapping of mRNA transcripts 4. polyadenylation 5. non-homologous end joining H. Splice sites in pre-mRN A are marked by two universally conserved dinucleotide sequences 1. in the middle of the intron . at the branch site ‘A’ at the ends of the introns at the ends of the exons meson . at the exon2intron junction of the first exon 4 flame —_ 2. ( 6 pts each! 18 pts total) Molecular biology is full of surprises. There are many cases in which a molecule is first characterized to function in one process or structure, and is subsequently found to have additional roles. For the three molecules listed below, state i) (3 pts.) its originally characterized function and ii) (3 points) a second, later characterized function for the molecule. e.g. Topoisomerase ll — i) discovered in bacteria as an enzyme that cleaves then reseals double-stranded DNA to control torsional stress. ii) ‘re-discovered’ as one of the major structural proteins of eukaryotic chromosomal protein scaffolds. A. histones H3 and H4 i) ii) B. TBP (TATA binding protein) 0 ii) C. TFIIH ii) 5 Name 3. (4 pts.) Fragments produced when DNA is cut with the restriction enzyme Spel can be directly ligated (that is, ligated without any modification of the ends of the fragments) to fragments produced by one of the following restriction enzymes. Which one? Circle the letter corresponding to the correct enzyme. A. HindIII B. EcoRV C. Xbal D. Xhol E. Sail 4. (6 pts.total) Cloning fragments by the strategy noted above is sometimes referred to as cloning with ‘compatible enzymes.’ BamHI and 33111 are also compatible enzymes. Here are their recognition sequences, with sites of cleavage on each strand indicated by the ‘/’ mark: Baml-II 5'-G/GATCC- 3’ Bglll 5‘-A/GATCT- 3' 3’-CCTAG/G- 5’ 3’-TCTAG/A~ 5’ A. (4 points) If a fragment with a BglII cut end was ligated to a fragment with a BamHI end, two different double stranded sequences could be generated. What are they? Write down the double-stranded DNA sequence for each of the two possible products of this ligation. Sequence 1: 5'- _ _ _ _ _ _ -3’ 3’- _ _ _ _ _ _ -5’ Sequence 2: 5’- _ _ _ _ _ _ -3' 3’- _ 5* B. (2 points) Which BgIII/BamHI hybrid sequence could be re-cleaved with Bgl [1? Circle your response: Sequence 1 Sequence 2 Both Neither 5. (10 pts. total) Consider this short segment of double-stranded DNA: 5’ - TAGACGTCGAAGGATCCAAAGGG - 3‘ 3' - ATCTGCAGCTTCCTAGGTTTCCC - 5' A. (8 points) How many potential common 6 base pair restriction enzyme recognition sites are there in this segment of double-stranded DNA? W: 1 2 4 23 4" 64 B. (2 points) Write down the sequence of one possible site. NV 8911 8003/9/9 ' ' I 1° I mnWWMNPo‘pson'an9mM/fldnu 939d mm 6 ame 6. ( 18 points total). Only one of the statements in each group is true. Correct m of the accompanying false statements, briefly explaining why each is false (3 poin Circle the number ofthe true statement and : w : ' -— 4.»: .- .- -. .- .-: -. .: .-. ---- .-. explaining. (3 points) Example: Operator constitutive mutants of the lac operon: l. express the lap repressor constitutiver — These are c_iS mutations, i.e., in the operon’s regulatory binding Slte and do not affect repressor expresswn ..'sr. . ts each). ' 3. express B—galactosidase constitutiver 4. revent inducer from binding the repressor These mutants prevent repressor binding to e operator; they do not affect repressor-inducer interactions. A. ( 9 points) 1. Transcripts of tRNA genes undergo 5’ and 3’ processing events that are distinct from those of pol I transcribed genes. 2. The base in the wobble position of the anticodon in tRNAs is the 3’ (third) base. 3. Although introns in tRNAs are usually smaller than those in pol II transcripts, they are also removed in two energy-independent steps. 4. The many copies of tRNA genes necessary for adequate protein translation are found as tandem repeats in the chromosomal satellites. B. (9 points) 1. Prokaryotic genes are often organized in polycistronic opcrons that contain multiple ribosomal binding sites and multiple polyadenylation sites. 2. Bacterial RNA polymerase I transcribes the pre-rRNA genes that will be processed into the 288, 188 and 5.88 subunits, whereas the SS rRNA is a product of pol 1H. 3. Complex transcription units in eukaryotes can give rise to distinct mRNAs by exon skipping or alternative splicing. 4. Transcriptional stop codons are near universally conserved; however in some mitochondrial genomes they may specify amino acids. NV 8531 8003/99“ ‘ ‘ I .10 I 41: ;‘ mumlwmmpo'pson'qamswan/flduq 98m mm 7 ame 7. (4 pts each] 44 points total). Following is a list of 15 molecules involved in key in viva biological processes. Select _1_1 of the 15 molecules. For each i) first denote the in vivo process (1 point), and then what ii) mat moleculg’s ml; is in the process (3 points). Draw a line through the-fi-emries—you do not want to be graded. c.g. W i) DNA replication—ii) an enzyme that copies a DNA template stmnd to make a eomplemcnmxy DNA. using deoxyribonucleotide triphosphatcs (dNTPs) as monomeric subunits A. exosome i) ii) B. W i) ii) C. TAfl segueng i) ii) D. splicggsgme i) ii) E. EABPI i) ii) F.PABP[1 i) ii) G. QRQ (Qflgin Recognition Complex) i) ii) NV 8931 8003/9/9 Wop'Jozmuafitalddeman/npa'pson'qamgwan/I:duq 8 Name 7. (cont’d., 4 pts each). For 11/ 15 molecules, i) first dengte the in viva pmcess (1 point), and then what ii) We is in the process (3 points). Draw a line through me-eaeies-you do not want to be graded. H. plimase i) ii) I. benzgf a Mama 1) ii) J. integrase i) ii) K. adengsine deaminase i) ii) L. LINES i) ii) M. _u 1) ii) N. snoRNAs i) ii) 0. telomerase i) ii) NV 8931 8003/99 " ' 15° I dsf'BAenoalap/domtfiwpmqawnpa'pson'an9wan1/tdml 9 Name _.__—_ 8. (14 points total). For each group of statements, one is m. Choose.2_o_f_th9_3_ groups to answer. Circle the number corresponding to the incorrect statement (3 points) and briefly explain why it is incorrect (4 points). Draw a line through the letter of the group (A, B, or G) that you do not want graded. A. l. EMSA is used to identify proteins binding to a cloned DNA sequence. 2. DNA fingerprinting is performed with Southern blots or PCR. 3. The 81 nuclease assay is used to define patterns of alternative splicing. 4. YACs are used to clone mega-base fragments of genomic DNA. B. l. Heterochromatin is rich in simple sequence repeat DNA. 2. Euchromatin is often enriched in highly acetylated histones. 3. Heterochromatin is usually transcriptionally inactive. 4. Chromatin immunoprecipitation (ChIP) is used to determine levels of transcription. C. 1. RNA pol II cannot by itself bind directly to a promoter. 2. Upstream regulatory regions often contain binding sites for both negatively and positively acting heterodimeric transcription factors. 3. A eukaryotic gene is defined by its sequence of DNA from the +1 transcription site to the 3’ end of its final exon. 4. Enhancers act to up-regulate gene transcription and may be found at great distances from the +1 site — upstream downstream, or even within introns. Exl a'n: Relalichesourchanagcr (applicationfpdf Object) httpszwcbctoweb.ucsd.cduf\rcbclfum'flc[585926132001.IplSQtlz 196." BIMM 100 Practice Final Please write your name on each page and look thJ Your exam should have 12 pages. The exam has ; question as directed. Please do not use pencil or ' you want graded is written in permanent ink. Note that all sequences are presented in 5' -> 3' 01 table have been provided as the last page of your itti'wp ii‘nrn [an l..* I. ---'\\1. Your score 1. 32 pts. 2. 18 pts. 3. 4 pts. 4. 6 pts. 5. 10 pts. lofl 10 ame 9. (34 points) Recent results suggest that the gene S UGI functions as transcriptional regulator for more than 50 genes in pancreatic and adipose tissue. You are particularly interested in SUGI because it appears to be mutated in many patients with severe Type II diabetes. Because Type II diabetes is such an important disease, a lot of progress has been made quickly on the study of S UGI . Both the human and mouse genes have been cloned from genomic libraries and cDNA libraries. The mouse gene is 95% identical to the human gene. A. (6 pts.) If the protein encoded by SUGI is a transcriptional regulator, a simple hypothesis is that it binds DNA. Briefly outline ONE experimental approach that you could use to identify a region of DNA that is bound by the S UGI -encoded protein. B. (6 pts.) You identify a 3 kb region of DNA from your experiments in A. Outline an experiment you could perform to test whether this region of DNA is functionally important for the regulation of S UGI target genes. C. (6 pts.) The proposal that S UGI regulates a large number of genes comes from microarray experiments. However, from these experiments, it appears that about half of the target genes are repressed and about half are activated. On the basis of what you know about domain structures of transcription factors, propose an explanation for this result. Queinlm continues on next page WV 891 8003/9/9 11° l mug-3 33939.1... < Iapl'dj 12mg < 5623 éfiou :uoneom .moA > dsf'xwosqmmopemq/uonoenoan/npa‘psan'qamgloan/I:dnu 11 Nm___________ D. (6 pts.) It turns out that when SUGI is knocked out in mice, the mutant embryos die, before pancreatic development is complete. In some regards, this is a good news because it suggests that the gene is likely to be very important. However, it is bad news if you want to study the role of SUGI in the pancreas. Suggest one alternate experimental approach that would allow you to study SUGI ’5 function in pancreatic cells. E. (3 pts.) How do you reconcile that the SUGI gene is essential in mice with the information that it is frequently mutated in human Type II diabetics, who are obviously alive as adults? . . . __ 7:“ “ "13“ F. (7 pts.) With the information from the experiments above, let’s think a bit more about me original microarray data. Commercially available microarrays were used. The only materials the investigators needed to provide were probes. Both ethical and practical considerations figured in choosing the probes to use. What material is likely to have been used? G. (7 pts.) You decide that it would be interesting to identify proteins that interact with SUGI and choose to use the two-hybrid assay. i) (2 pts.) Specify 1 reason this may prove to be an informative approach in understanding SUGI function. ii) (3 pts.) Specify 1 problem you may have with the assay that derives from what you already know about SUGI function? iii) (2 pts.) Suggest one strategy that might help you eliminate this problem. WV 891 8001799 110 I , snoo; asmoa - “96123069 I 511' IOUZEL‘RfiSSS I 3135\1'1fl3q35‘fnpo‘P53“‘93-“91999flflid1111 "HOW 953103 12 MEL.— E . . E B . . S HindIlI NAGCTI' 'I'l‘CGA/A EcaRV GATIATC CI‘AII‘AG Sal! GII'CGAC CAGCT/G SpeI AICTAGT TGATC/A Sml AGG/CCT TCC/GGA Xbal TICI'AGA AGATCIT XhaI CITCGAG GAGCTIC WV 89:! 8002399 11° I snmd fiuuds sooz - our man “‘961zoasldrI00215936989Iovmnmqommpo'wn'm9mflidml ...
View Full Document

Page1 / 21

BIMM 100 - pillus practice final - Name Practice Final H...

This preview shows document pages 1 - 21. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online