Practice exam 2 - 1. Which of the following is NOT a...

Info iconThis preview shows pages 1–4. Sign up to view the full content.

View Full Document Right Arrow Icon
1. Which of the following is NOT a difference between RNA and DNA?  a. Sugar – ribose vs. deoxyribose b. 2’-OH c. 3’-OH d. Base - Uracil vs. Thymines e. None of the above. Questions  2-7:  Following is a diagram of replication in process.  2. What is the name of the element labeled #23?  a. Leading strand  b. Topoisomerase 23 25 26 24 3’ 5’ 27
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
c. Okazaki fragment d. RNA primer e. Helicase 3. What is the name of the element labeled #24?  a. Leading strand b. Topoisomerase c. Okazaki fragment d. RNA primer e. Helicase 4. What is the name of the element labeled #25?  a. Leading strand b. Topoisomerase c. Okazaki fragment d. RNA primer e. Helicase 5. What is the name of the protein labeled #26?  a. DNA polymerase I b. RNA primase c. Topoisomerase d. DNA polymerase III e. Helicase 6. What is the name of the protein labeled #27?  a. DNA polymerase I b. RNA primase c. Topoisomerase d. DNA polymerase III e. Helicase 7. Which of the following is NOT TRUE regarding the processing of the 3’ end of RNA  transcripts?  a. Is modified by the addition of 7-methyl guanosine cap. b. Is modified by the addition of a polyA tail. c. Has a polyadenylation signal; AAUAAA or AUUAAA, near the 3´ end of the transcript. d. Is modified by the splicing machinery. e. a and d
Background image of page 2
Questions 8-11:  The mRNA sequence of a gene is shown below. Answer questions 8- 11 using this. Wild type:   5’  CCAGCAUAUGCCUAAUCGCAGUUCGGAAUAGCAAGCC  3’ 8. What is the sequence of the coding strand?  a. 5’-CCAGCAUAUGCCUAAUCGCAGUUCGGAAUAGCAAGCC-3’ b. 3’-CCAGCATATGCCTAATCGCAGTTCGGAATAGCAAGCC-5’ c. 5’-GGTCGTATACGGATTAGCGTCAAGCCTTATCGTTCGG-3’ d. 5’-CCAGCATATGCCTAATCGCAGTTCGGAATAGCAAGCC-3’
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 4
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 10/29/2008 for the course BIOL 3301 taught by Professor Gunaratne during the Spring '05 term at University of Houston.

Page1 / 9

Practice exam 2 - 1. Which of the following is NOT a...

This preview shows document pages 1 - 4. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online