ps3s - MIT Department of Biology 7.014 Introductory...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: MIT Department of Biology 7.014 Introductory Biology, Spring 2004 Solutions to 7.014 Problem Set 3 Question 1 Hypothetical organism X has the following DNA sequence. Part of the promoter is indicated by the boxed sequence. Transcription starts at and includes the bold A/T base pair. 5 xxxx TATTTGAT A G CTCTATGCAT GCATGGGTCC TGAAGTTCAG ATCTTTGAGT CATAGGAGTC 3 3 xxxx ATAAACTA T C GAGATACGTA CGTACCCAGG ACTTCAAGTC TAGAAACTCA GTATCCTCAG 5 a) Give the RNA sequence of the first 25 bases following transcription. 5 AGCUCUAUGCAUGCAUGGGUCCUGA 3 b) What are the first 5 amino acids of the resulting protein? 5 AUG CAU GCA UGG GUC CUG Met HIS ALA TRP VAL LEU c) Finish translating the following mRNA sequence. 1 5 AUA UUU AUG CAU GGG ACU UAU AGC GAU AGC UAC UAA CAU AAG 3 ile phe met his gly thr tyr ser asp ser tyr d) The organism that makes the above RNA sequence is exposed to a mutagen. What does a mutagen do? A mutagen alters the DNA sequence of an organism. e) For each of the following mutations, identify the type of mutation (insertion, deletion, point, or silent) that occurred in the DNA and the affect on the resulting protein. Consider each mutation independently....
View Full Document

This note was uploaded on 05/02/2009 for the course BIOL 7.014 taught by Professor Walker during the Spring '05 term at MIT.

Page1 / 4

ps3s - MIT Department of Biology 7.014 Introductory...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online