ps3s - MIT Department of Biology 7.014 Introductory Biology...

Info icon This preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
MIT Department of Biology 7.014 Introductory Biology, Spring 2004 Solutions to 7.014 Problem Set 3 Question 1 Hypothetical organism X has the following DNA sequence. Part of the promoter is indicated by the boxed sequence. Transcription starts at and includes the bold A/T base pair. 5’ xxxx TATTTGAT A G CTCTATGCAT GCATGGGTCC TGAAGTTCAG ATCTTTGAGT CATAGGAGTC 3’ 3’ xxxx ATAAACTA T C GAGATACGTA CGTACCCAGG ACTTCAAGTC TAGAAACTCA GTATCCTCAG 5’ a) Give the RNA sequence of the first 25 bases following transcription. 5’ AGCUCUAUGCAUGCAUGGGUCCUGA 3’ b) What are the first 5 amino acids of the resulting protein? 5’ AUG CAU GCA UGG GUC CUG Met HIS ALA TRP VAL LEU c) Finish translating the following mRNA sequence. 1 5’ AUA UUU AUG CAU GGG ACU UAU AGC GAU AGC UAC UAA CAU AAG 3’ ile phe met his gly thr tyr ser asp ser tyr d) The organism that makes the above RNA sequence is exposed to a mutagen. What does a mutagen do? A mutagen alters the DNA sequence of an organism. e) For each of the following mutations, identify the type of mutation (insertion, deletion, point, or silent) that occurred in the DNA and the affect on the resulting protein. Consider each mutation independently.
Image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern